Login to display prices
Login to display prices
PDPK1-3-phosphoinositide dependent protein kinase-1 Gene View larger

PDPK1-3-phosphoinositide dependent protein kinase-1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDPK1-3-phosphoinositide dependent protein kinase-1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PDPK1-3-phosphoinositide dependent protein kinase-1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006339
Product type: DNA & cDNA
Ncbi symbol: PDPK1
Origin species: Human
Product name: PDPK1-3-phosphoinositide dependent protein kinase-1 Gene
Size: 2ug
Accessions: BC006339
Gene id: 5170
Gene description: 3-phosphoinositide dependent protein kinase-1
Synonyms: PDK1; PDPK2; PDPK2P; PRO0461; 3-phosphoinositide-dependent protein kinase 1; 3-phosphoinositide-dependent protein kinase 2 pseudogene; PkB kinase like gene 1; 3-phosphoinositide dependent protein kinase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaggaccaccagccagctgtatgacgccgtgcccatccagtccagcgtggtgttatgttcctgcccatccccatcaatggtgaggacccagactgagtccagcacgccccctggcattcctggtggcagcaggcagggccccgccatggacggcactgcagccgagcctcggcccggcgccggctccctgcagcatgcccagcctccgccgcagcctcggaagaagcggcctgaggacttcaagtttgggaaaatccttggggaaggctctttttccacggttgtcctggctcgagaactggcaacctccagagaatatgcgaccagggccaactcattcgtgggaacagcgcagtacgtttctccagagctgctcacggagaagtccgcctgtaagagttcagacctttgggctcttggatgcataatataccagcttgtggcaggactcccaccattccgagctggaaacgagtatcttatatttcagaagatcattaagttggaatatgactttccagaaaaattcttccctaaggcaagagacctcgtggagaaacttttggttttagatgccacaaagcggttaggctgtgaggaaatggaaggatacggacctcttaaagcacacccgttcttcgagtccgtcacgtgggagaacctgcaccagcagacgcctccgaagctcaccgcttacctgccggctatgtcggaagacgacgaggactgctatggcaattatgacaatctcctgagccagtttggctgcatgcaggtgtcttcgtcctcctcctcacactccctgtcagcctccgacacgggcctgccccagaggtcaggcagcaacatagagcagtacattcacgatctggactcgaactcctttgaactggacttacagttttccgaagatgagaagaggttgttgttggagaagcaggctggcggaaacccttggcaccagtttgtagaaaataatttaatactaaagatgggcccagtggataagcggaagggtttatttgcaagacgacgacagctgttgctcacagaaggaccacatttatattatgtggatcctgtcaacaaagttctgaaaggtgaaattccttggtcacaagaacttcgaccagaggccaagaattttaaaactttctttgtccacacgcctaacaggacgtattatctgatggaccccagcgggaacgcacacaagtggtgcaggaagatccaggaggtttggaggcagcgataccagagccacccggacgccgctgtgcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tubulin, gamma complex associated protein 3
- family with sequence similarity 63, member A
- pre-mRNA cleavage factor I, 59 kDa subunit
- peptidylprolyl isomerase (cyclophilin)-like 4