FLJ12529-pre-mRNA cleavage factor I, 59 kDa subunit Gene View larger

FLJ12529-pre-mRNA cleavage factor I, 59 kDa subunit Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FLJ12529-pre-mRNA cleavage factor I, 59 kDa subunit Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FLJ12529-pre-mRNA cleavage factor I, 59 kDa subunit Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018135
Product type: DNA & cDNA
Ncbi symbol: FLJ12529
Origin species: Human
Product name: FLJ12529-pre-mRNA cleavage factor I, 59 kDa subunit Gene
Size: 2ug
Accessions: BC018135
Gene id: 79869
Gene description: pre-mRNA cleavage factor I, 59 kDa subunit
Synonyms: CFIm59; cleavage and polyadenylation specificity factor subunit 7; CPSF 59 kDa subunit; cleavage and polyadenylation specificity factor 59 kDa subunit; cleavage factor Im complex 59 kDa subunit; pre-mRNA cleavage factor I, 59 kDa subunit; pre-mRNA cleavage factor Im 59 kDa subunit; cleavage and polyadenylation specific factor 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagaaggagtggacttgattgatatatatgctgacgaggagttcaaccaggacccagagttcaacaatacagatcagattgacctgtatgatgatgtgctgacagccacctcacagccctcagatgacagaagcagcagcactgaaccacctcctcctgttcgccaggagccatctcccaagcccaacaacaagacccctgcaattctgtatacctacagtggcctgcgtaatagacgagctgccgtttatgtgggcagcttctcctggtggaccacagaccagcagctgatccaggttattcgctctataggagtctatgatgtggtggagttgaaatttgcagagaatcgagcaaatggccagtccaaagggtatgctgaggtggtggtagcctctgaaaactctgtccacaaattgttggaactcctaccagggaaagttcttaatggagaaaaagtggacgtgaggccggccacccggcagaacctgtcacagtttgaggcacaggctcggaaacgtgagtgtgtccgagtcccaagagggggaatacctccacgggcccattcccgagattctagtgattctgctgatggacgggccacaccctctgagaaccttgtaccctcatctgctcgtgtggataagccccccagtgtgctgccctacttcaatcgtcctccttcggcccttcccctgatgggtctgcccccaccaccaattccacccccaccacctctctcctcaagctttggggtccctcctcctcctcctggtatccactaccagcatctcatgcccccacctcctcgattacctcctcatcttgctgtacctccccctggggccatcccacctgcccttcacctcaatccagccttcttccccccaccaaacgctacagtggggcctccaccagatacttacatgaaggcctctgccccctataaccaccatggcagccgagattcgggccctccaccctctacagtgagtgaagccgaatttgaagatatcatgaagcgaaacagagcaatttccagcagtgccatttccaaagcagtatctggagccagtgcaggggattacagtgacgcaattgagacgctgctcacagccattgcggttatcaaacagtcccgggttgccaatgatgagcgttgccgtgtcctcatctcctctcttaaggactgtcttcatggcattgaagccaagtcctacagtgtgggtgccagtgggagctcttccaggaaaagacatcgctcccgggaaaggtcacctagccggtcccgggagagcagcaggaggcaccgggatctgcttcataatgaagatcggcatgatgattatttccaagaaaggaaccgggagcatgagagacaccgggatagagaacgggaccggcaccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peptidylprolyl isomerase (cyclophilin)-like 4
- poly (ADP-ribose) polymerase family, member 3
- CWF19-like 1, cell cycle control (S. pombe)
- family with sequence similarity 55, member C

Buy FLJ12529-pre-mRNA cleavage factor I, 59 kDa subunit Gene now

Add to cart