Login to display prices
Login to display prices
PARP3-poly (ADP-ribose) polymerase family, member 3 Gene View larger

PARP3-poly (ADP-ribose) polymerase family, member 3 Gene


New product

Data sheet of PARP3-poly (ADP-ribose) polymerase family, member 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PARP3-poly (ADP-ribose) polymerase family, member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014260
Product type: DNA & cDNA
Ncbi symbol: PARP3
Origin species: Human
Product name: PARP3-poly (ADP-ribose) polymerase family, member 3 Gene
Size: 2ug
Accessions: BC014260
Gene id: 10039
Gene description: poly (ADP-ribose) polymerase family, member 3
Synonyms: ADPRT3; ADPRTL2; ADPRTL3; ARTD3; IRT1; PADPRT-3; poly [ADP-ribose] polymerase 3; ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 2; ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 3; ADP-ribosyltransferase diphtheria toxin-like 3; ADPRT-3; NAD(+) ADP-ribosyltransferase 3; NAD+ ADP-ribosyltransferase 3; poly(ADP-ribose) synthetase-3; poly[ADP-ribose] synthase 3; poly[ADP-ribose] synthetase 3; poly(ADP-ribose) polymerase family member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctccaaagccgaagccctgggtacagactgagggccctgagaagaagaagggccggcaggcaggaagggaggaggaccccttccgctccaccgctgaggccctcaaggccatacccgcagagaagcgcataatccgcgtggatccaacatgtccactcagcagcaaccccgggacccaggtgtatgaggactacaactgcaccctgaaccagaccaacatcgagaacaacaacaacaagttctacatcatccagctgctccaagacagcaaccgcttcttcacctgctggaaccgctggggccgtgtgggagaggtcggccagtcaaagatcaaccacttcacaaggctagaagatgcaaagaaggactttgagaagaaatttcgggaaaagaccaagaacaactgggcagagcgggaccactttgtgtctcacccgggcaagtacacacttatcgaagtacaggcagaggatgaggcccaggaagctgtggtgaaggtggacagaggcccagtgaggactgtgactaagcgggtgcagccctgctccctggacccagccacgcagaagctcatcactaacatcttcagcaaggagatgttcaagaacaccatggccctcatggacctggatgtgaagaagatgcccctgggaaagctgagcaagcaacagattgcacggggtttcgaggccttggaggcgctggaggaggccctgaaaggccccacggatggtggccaaagcctggaggagctgtcctcacacttttacaccgtcatcccgcacaacttcggccacagccagcccccgcccatcaattcccctgagcttctgcaggccaagaaggacatgctgctggtgctggcggacatcgagctggcccaggccctgcaggcagtctctgagcaggagaagacggtggaggaggtgccacaccccctggaccgagactaccagcttctcaagtgccagctgcagctgctagactctggagcacctgagtacaaggtgatacagacctacttagaacagactggcagcaaccacaggtgccctacacttcaacacatctggaaagtaaaccaagaaggggaggaagacagattccaggcccactccaaactgggtaatcggaagctgctgtggcatggcaccaacatggccgtggtggccgccatcctcactagtgggctccgcatcatgccacattctggtgggcgtgttggcaagggcatctactttgcctcagagaacagcaagtcagctggatatgttattggcatgaagtgtggggcccaccatgtcggctacatgttcctgggtgaggtggccctgggcagagagcaccatatcaacacggacaaccccagcttgaagagcccacctcctggcttcgacagtgtcattgcccgaggccacaccgagcctgatccgacccaggacactgagttggagctggatggccagcaagtggtggtgccccagggccagcctgtgccctgcccagagttcagcagctccacattctcccagagcgagtacctcatctaccaggagagccagtgtcgcctgcgctacctgctggaggtccacctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CWF19-like 1, cell cycle control (S. pombe)
- family with sequence similarity 55, member C
- tubulin tyrosine ligase-like family, member 6
- glutamine-fructose-6-phosphate transaminase 2