TUBGCP3-tubulin, gamma complex associated protein 3 Gene View larger

TUBGCP3-tubulin, gamma complex associated protein 3 Gene

PTXBC007763

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TUBGCP3-tubulin, gamma complex associated protein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TUBGCP3-tubulin, gamma complex associated protein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007763
Product type: DNA & cDNA
Ncbi symbol: TUBGCP3
Origin species: Human
Product name: TUBGCP3-tubulin, gamma complex associated protein 3 Gene
Size: 2ug
Accessions: BC007763
Gene id: 10426
Gene description: tubulin, gamma complex associated protein 3
Synonyms: 104p; GCP3; Grip104; SPBC98; Spc98; Spc98p; gamma-tubulin complex component 3; gamma-ring complex protein 104 kDa; spindle pole body protein Spc98 homolog; tubulin gamma complex associated protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaccccggaccagaagtcgccgaacgttctgctgcagaacctgtgctgcaggatcctgggcaggagcgaagctgatgtagcccagcagttccagtatgctgtgcgggtgattggcagcaacttcgccccaactgttgaaagagatgaatttttagtagctgaaaaaatcaagaaagagcttattcgacaacgaagagaagcagatgctgcattattttcagaactccacagaaaacttcattcacagggagttttgaaaaataaatggtcaatactctacctcttgctgagcctcagtgaggacccacgcaggcagccaagcaaggtttctagctatgctacgttatttgctcaggccttaccaagagatgcccactcaaccccttactactatgccaggcctcagacccttcccctgagctaccaagatcggagtgcccagtcagcccagagctccggcagcgtgggcagcagtggcatcagcagcattggcctgtgtgccctcagtggccccgcgcctgcgccacaatctctcctcccaggacagtctaatcaagctccaggagtaggagattgccttcgacagcagttggggtcacgactcgcatggactttaactgcaaatcagccttcttcacaagccactacctcaaaaggtgtccccagtgctgtgtctcgcaacatgacaaggtccaggagagaaggggatacgggtggtactatggaaattacagaagcagctctggtaagggacattttgtacgtctttcagggcatagatggcaaaaacatcaaaatgaacaacactgaaaattgttacaaagtagaaggaaaggcaaatctaagtaggtctttgagagacacagcagtcaggctttctgagttgggatggttgcataataaaatcagaagatacacggaccagaggagcctggaccgctcattcggactcgtcgggcagagcttttgtgctgccttgcaccaggaactcagagaatactatcgattgctctctgttttacattctcagctacaactagaggatgaccagggtgtgaatttgggacttgagagtagtttaacacttcggcgcctcctggtttggacctatgatcccaaaatacgactgaagacccttgcggccctagtggaccactgccaaggtcccacgcgcgtctttcccacgcacgtctttcccacgcgcgactttcccacgcgcgactttcccatgcacgtctttcccacgcgcgtctttcccacgcgcgtctggcactcgctttgtttcagaactcgtttgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 63, member A
- pre-mRNA cleavage factor I, 59 kDa subunit
- peptidylprolyl isomerase (cyclophilin)-like 4
- poly (ADP-ribose) polymerase family, member 3

Buy TUBGCP3-tubulin, gamma complex associated protein 3 Gene now

Add to cart