Login to display prices
Login to display prices
TUBGCP3-tubulin, gamma complex associated protein 3 Gene View larger

TUBGCP3-tubulin, gamma complex associated protein 3 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TUBGCP3-tubulin, gamma complex associated protein 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TUBGCP3-tubulin, gamma complex associated protein 3 Gene

Proteogenix catalog: PTXBC007763
Ncbi symbol: TUBGCP3
Product name: TUBGCP3-tubulin, gamma complex associated protein 3 Gene
Size: 2ug
Accessions: BC007763
Gene id: 10426
Gene description: tubulin, gamma complex associated protein 3
Synonyms: 104p; GCP3; Grip104; SPBC98; Spc98; Spc98p; gamma-tubulin complex component 3; gamma-ring complex protein 104 kDa; spindle pole body protein Spc98 homolog; tubulin gamma complex associated protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaccccggaccagaagtcgccgaacgttctgctgcagaacctgtgctgcaggatcctgggcaggagcgaagctgatgtagcccagcagttccagtatgctgtgcgggtgattggcagcaacttcgccccaactgttgaaagagatgaatttttagtagctgaaaaaatcaagaaagagcttattcgacaacgaagagaagcagatgctgcattattttcagaactccacagaaaacttcattcacagggagttttgaaaaataaatggtcaatactctacctcttgctgagcctcagtgaggacccacgcaggcagccaagcaaggtttctagctatgctacgttatttgctcaggccttaccaagagatgcccactcaaccccttactactatgccaggcctcagacccttcccctgagctaccaagatcggagtgcccagtcagcccagagctccggcagcgtgggcagcagtggcatcagcagcattggcctgtgtgccctcagtggccccgcgcctgcgccacaatctctcctcccaggacagtctaatcaagctccaggagtaggagattgccttcgacagcagttggggtcacgactcgcatggactttaactgcaaatcagccttcttcacaagccactacctcaaaaggtgtccccagtgctgtgtctcgcaacatgacaaggtccaggagagaaggggatacgggtggtactatggaaattacagaagcagctctggtaagggacattttgtacgtctttcagggcatagatggcaaaaacatcaaaatgaacaacactgaaaattgttacaaagtagaaggaaaggcaaatctaagtaggtctttgagagacacagcagtcaggctttctgagttgggatggttgcataataaaatcagaagatacacggaccagaggagcctggaccgctcattcggactcgtcgggcagagcttttgtgctgccttgcaccaggaactcagagaatactatcgattgctctctgttttacattctcagctacaactagaggatgaccagggtgtgaatttgggacttgagagtagtttaacacttcggcgcctcctggtttggacctatgatcccaaaatacgactgaagacccttgcggccctagtggaccactgccaaggtcccacgcgcgtctttcccacgcacgtctttcccacgcgcgactttcccacgcgcgactttcccatgcacgtctttcccacgcgcgtctttcccacgcgcgtctggcactcgctttgtttcagaactcgtttgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: