PAIP1-poly(A) binding protein interacting protein 1 Gene View larger

PAIP1-poly(A) binding protein interacting protein 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PAIP1-poly(A) binding protein interacting protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PAIP1-poly(A) binding protein interacting protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005295
Product type: DNA & cDNA
Ncbi symbol: PAIP1
Origin species: Human
Product name: PAIP1-poly(A) binding protein interacting protein 1 Gene
Size: 2ug
Accessions: BC005295
Gene id: 10605
Gene description: poly(A) binding protein interacting protein 1
Synonyms: polyadenylate-binding protein-interacting protein 1; PABC1-interacting protein 1; PABP-interacting protein 1; PAIP-1; poly(A) binding protein interacting protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggacggtttcgatcgggccccagagcaaacgaggcccctgagagctccacctagttcacaggataaaatcccacagcagaactcggagtcagcaatggctaagccccaggtggttgtagctcctgtattaatgtctaagctgtctgtgaatgcccctgaattttacccttcaggttattcttccagttacacagaatcctatgaggatggttgtgaggattatcctactctatcagaatatgttcaggattttttgaatcatcttacagagcagcctggcagttttgaaactgaaattgaacagtttgcagagaccctgaatggttgtgttacaacagatgatgctttgcaagaacttgtggaactcatctatcaacaggccacatctatcccaaatttctcttatatgggagctcgcctgtgtaattacctgtcccatcatctgacaattagcccacagagtggcaacttccgccaattgctacttcaaagatgtcggactgaatatgaagttaaagatcaagctgcaaaaggggatgaagttactcgaaaacgatttcatgcatttgtactctttctgggagaactttatcttaacctggagatcaagggaacaaatggacaggttacaagagcagatattcttcaggttggtcttcgagaattgctgaatgccctgttttctaatcctatggatgacaatttaatttgtgcagtaaaattgttaaagttgacaggatcagttttggaagatgcttggaaggaaaaaggaaagatggatatggaagaaattattcagagaattgaaaacgttgtcctagatgcaaactgcagtagagatgtaaaacagatgctcttgaagcttgtagaactccggtcaagtaactggggcagagtccatgcaacttcaacatatagagaagcaacaccagaaaatgatcctaactactttatgaatgaaccaacattttatacatctgatggtgttcctttcactgcagctgatccagattaccaagagaaataccaagaattacttgaaagagaggacttttttccagattatgaagaaaatggaacagatttatccggggctggtgatccatacttggatgatattgatgatgagatggacccagagatagaagaagcttatgaaaagttttgtttggaatcagagcgtaagcgaaaacagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphoinositide-3-kinase adaptor protein 1
- family with sequence similarity 55, member A
- family with sequence similarity 81, member B
- family with sequence similarity 46, member B

Buy PAIP1-poly(A) binding protein interacting protein 1 Gene now

Add to cart