FAM54B-family with sequence similarity 54, member B Gene View larger

FAM54B-family with sequence similarity 54, member B Gene

PTXBC017175

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM54B-family with sequence similarity 54, member B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM54B-family with sequence similarity 54, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017175
Product type: DNA & cDNA
Ncbi symbol: FAM54B
Origin species: Human
Product name: FAM54B-family with sequence similarity 54, member B Gene
Size: 2ug
Accessions: BC017175
Gene id: 56181
Gene description: family with sequence similarity 54, member B
Synonyms: protein FAM54B; FAM54B; HYST1888; MST116; MSTP116; mitochondrial fission regulator 1-like; family with sequence similarity 54 member B; mitochondrial fission regulator 1 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcaggaatggaagccactgtgaccatcccaatctggcaaaacaagccacatggggctgctcgaagtgtagtaagaagaattgggaccaacctacccttgaagccgtgtgcccgggcgtcctttgagaccctgcccaacatctctgacctgtgtttgagagatgtgcccccagtccctaccctggctgacatcgcctggattgctgcggatgaagaggagacatatgcccgggtcaggagtgatacgcgccccctgaggcacacctggaaacccagccctctgattgtcatgcagcgcaatgcctctgttcccaacctgcgtgggtccgaggagaggcttctggccctgaagaagccagctctgccagccctaagccgcactactgagctgcaggacgagctgagccacttgcgcagccagattgcaaagatagtggcagctgatgcagcttcggcttcattaacgccagatttcttatctccaggaagttcaaatgtctcttctcccttaccttgttttggatcctcattccactctacaacttcctttgtcattagtgacatcaccgaggagacagaggtggaggtccctgagcttccatcagtccccctgctttgttctgccagccctgaatgttgcaaaccagaacacaaagctgcctgcagttcgtctgaagaggatgactgcgtctctttgtccaaggccagcagctttgcagacatgatgggtatcctgaaggactttcaccgaatgaaacagagtcaagatctgaaccggagtttattgaaggaggaagaccctgctgtgcttatctctgaggtcctaaggaggaagtttgctctaaaggaagaagatatcagtagaaaaggaaattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 83, member A
- dehydrogenase/reductase (SDR family) member 3
- STIP1 homology and U-box containing protein 1
- family with sequence similarity 82, member B

Buy FAM54B-family with sequence similarity 54, member B Gene now

Add to cart