Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of MUDENG-MU-2/AP1M2 domain containing, death-inducing Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MUDENG-MU-2/AP1M2 domain containing, death-inducing Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013174 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MUDENG |
| Origin species: | Human |
| Product name: | MUDENG-MU-2/AP1M2 domain containing, death-inducing Gene |
| Size: | 2ug |
| Accessions: | BC013174 |
| Gene id: | 55745 |
| Gene description: | MU-2/AP1M2 domain containing, death-inducing |
| Synonyms: | MUDENG; C14orf108; Mu5; MuD; AP-5 complex subunit mu-1; AP-5 complex subunit mu; MHD domain-containing death-inducing protein; MU-2/AP1M2 domain containing, death-inducing; Mu-2 related death-inducing; adapter-related protein complex 5 mu subunit; adapter-related protein complex 5 subunit mu-1; adaptor-related protein complex 5 subunit mu-1; mu-2-related death-inducing protein; adaptor related protein complex 5 mu 1 subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgcagcgggcagtgtggctcataagccacgaaccgggaactccactttgtggcaccgtgagattctccagacggtatccaactgttgaaaaacgagccagagtcttcaatggagcaagttatgtgcctgttcctgaagatggtccctttcttaaagcactgctctttgaacttagattattggatgatgataaagacttcgttgagagtcgtgatagctgttcacgcatcaataaaacatccatttatggactcctgataggaggtgaagaactctggccagttgttgcttttctgaagaatgacatgatatatgcttgtgttccactagttgaacaaactctgtcccctcgtccgccactaattagtgtcagtggagtttcacaaggctttgaatttctttttgggatacaggattttctttattcaggtcaaaaaaatgactctgagctgaatacaaaattgagccagttgcctgacttgcttctgcaggcttgtccatttggtactttattagatgccaacttacagaattcattagataataccaattttgcatctgtgactcagccacagaaacagccagcttggaaaactgggacgtacaaaggaaaaccacaagtttctatttctatcactgaaaaggtaaaatccatgcaatatgataaacagggtatagcagatacatggcaagttgttggaacagtgacttgcaaggtgagatttttctctggtacttgctttatcgttttatttaacatatggagaaaagttaaatttgctagttgtattttaaataacattttttattttcatcttaagcagcagtttttaaatgggagagtcatgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 54, member B - family with sequence similarity 83, member A - dehydrogenase/reductase (SDR family) member 3 - STIP1 homology and U-box containing protein 1 |