MUDENG-MU-2/AP1M2 domain containing, death-inducing Gene View larger

MUDENG-MU-2/AP1M2 domain containing, death-inducing Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MUDENG-MU-2/AP1M2 domain containing, death-inducing Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MUDENG-MU-2/AP1M2 domain containing, death-inducing Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013174
Product type: DNA & cDNA
Ncbi symbol: MUDENG
Origin species: Human
Product name: MUDENG-MU-2/AP1M2 domain containing, death-inducing Gene
Size: 2ug
Accessions: BC013174
Gene id: 55745
Gene description: MU-2/AP1M2 domain containing, death-inducing
Synonyms: MUDENG; C14orf108; Mu5; MuD; AP-5 complex subunit mu-1; AP-5 complex subunit mu; MHD domain-containing death-inducing protein; MU-2/AP1M2 domain containing, death-inducing; Mu-2 related death-inducing; adapter-related protein complex 5 mu subunit; adapter-related protein complex 5 subunit mu-1; adaptor-related protein complex 5 subunit mu-1; mu-2-related death-inducing protein; adaptor related protein complex 5 mu 1 subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcagcgggcagtgtggctcataagccacgaaccgggaactccactttgtggcaccgtgagattctccagacggtatccaactgttgaaaaacgagccagagtcttcaatggagcaagttatgtgcctgttcctgaagatggtccctttcttaaagcactgctctttgaacttagattattggatgatgataaagacttcgttgagagtcgtgatagctgttcacgcatcaataaaacatccatttatggactcctgataggaggtgaagaactctggccagttgttgcttttctgaagaatgacatgatatatgcttgtgttccactagttgaacaaactctgtcccctcgtccgccactaattagtgtcagtggagtttcacaaggctttgaatttctttttgggatacaggattttctttattcaggtcaaaaaaatgactctgagctgaatacaaaattgagccagttgcctgacttgcttctgcaggcttgtccatttggtactttattagatgccaacttacagaattcattagataataccaattttgcatctgtgactcagccacagaaacagccagcttggaaaactgggacgtacaaaggaaaaccacaagtttctatttctatcactgaaaaggtaaaatccatgcaatatgataaacagggtatagcagatacatggcaagttgttggaacagtgacttgcaaggtgagatttttctctggtacttgctttatcgttttatttaacatatggagaaaagttaaatttgctagttgtattttaaataacattttttattttcatcttaagcagcagtttttaaatgggagagtcatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 54, member B
- family with sequence similarity 83, member A
- dehydrogenase/reductase (SDR family) member 3
- STIP1 homology and U-box containing protein 1

Buy MUDENG-MU-2/AP1M2 domain containing, death-inducing Gene now

Add to cart