Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TTLL5-tubulin tyrosine ligase-like family, member 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TTLL5-tubulin tyrosine ligase-like family, member 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002766 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TTLL5 |
| Origin species: | Human |
| Product name: | TTLL5-tubulin tyrosine ligase-like family, member 5 Gene |
| Size: | 2ug |
| Accessions: | BC002766 |
| Gene id: | 23093 |
| Gene description: | tubulin tyrosine ligase-like family, member 5 |
| Synonyms: | tubulin polyglutamylase TTLL5; CORD19; KIAA0998; STAMP; SRC1 and TIF2 associated binding protein; SRC1 and TIF2-associated modulatory protein; tubulin tyrosine ligase-like family, member 5; tubulin tyrosine ligase like 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccaatcgtgatggcccgggacctggaggaaacagcatcatcctcagaggatgaggaggtcataagtcaagaggatcatccatgcatcatgtggactggaggctgcaggagaattccagttttggtattccatgccgacgctattcttacaaaggacaacaatattagagtaattggagaacgttatcatttgtcttataagattgtacgaacggacagtcgcctagtacgcagcattctgacagcccatggatttcatgaagttcacccaagcagcactgactataacctaatgtggacaggatcccacctgaagcccttcttactgcgcaccctctctgaagcacaaaaagttaatcactttcccaggtcttatgaacttacccggaaggaccgactgtacaaaaacattattcgaatgcagcatacacatggattcaaggcttttcacatcctcccccagaccttcctcctgccagctgagtacgcggaattttgtaattcatattcgaaggaccggggaccttggatagtaaaaccagtggcatcttcaagggggcggggcgtctacctgatcaacaatccaaaccagatctccctggaagacaacattttggtctcccgttacattaacaaccccctgctcatagatgatttcaagtttgacatgcgcctctatgtgctcgtgacttcctatgatcctcttgtcatctatctctatgaagaaggattggctagaaaatgcaattggaagatgggaaataccatggataaaagaaggctacctatttatgtacaggtgctttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - insulin-like growth factor binding protein 5 - family with sequence similarity 44, member A - MU-2/AP1M2 domain containing, death-inducing - family with sequence similarity 54, member B |