Cart 7 Product Products 1 087,10 € (empty)
-
1 x LOC400713-...113,40 € -
1 x CRIP1-cyst...113,40 € -
1 x CCR1-chemo...121,50 € -
1 x PPP1R11-pr...113,40 € -
-
-
1 x CXCL5-chem...113,40 €
No products
To be determined Shipping
1 087,10 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 087,10 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 087,10 €
View larger 
Data sheet of DHRS2-dehydrogenase/reductase (SDR family) member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DHRS2-dehydrogenase/reductase (SDR family) member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007339 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DHRS2 |
| Origin species: | Human |
| Product name: | DHRS2-dehydrogenase/reductase (SDR family) member 2 Gene |
| Size: | 2ug |
| Accessions: | BC007339 |
| Gene id: | 10202 |
| Gene description: | dehydrogenase/reductase (SDR family) member 2 |
| Synonyms: | HEP27; SDR25C1; dehydrogenase/reductase SDR family member 2, mitochondrial; dehydrogenase/reductase (SDR family) member 2; dehydrogenase/reductase member 2; dicarbonyl reductase HEP27; protein D; short chain dehydrogenase/reductase family 25C member 1; short-chain alcohol dehydrogenase family member; dehydrogenase/reductase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcagcaccgggatagacaggaagggcgtcctggctaaccgggtagccgtggtcacggggtccaccagtgggatcggctttgccatcgcccgacgtctggcccgggacggggcccacgtggtcatcagcagccggaagcagcagaacgtggaccgggccatggccaagctgcagggggaggggctgagtgtggcgggcattgtgtgccacgtggggaaggctgaggaccgggagcagctggtggccaaggccctggagcactgtgggggcgtcgacttcctggtgtgcagcgcaggggtcaaccctctggtagggagcactctggggaccagtgagcagatctgggacaagatcctaagtgtgaacgtgaagtccccagccctgctgctgagccagttgctgccctacatggagaacaggaggggtgctgtcatcctggtctcttccattgcagcttataatccagtagtggcgctgggtgtctacaatgtcagcaagacagcgctgctgggtctcactagaacactggcattggagctggcccccaaggacatccgggtaaactgcgtggttccaggaattatcaaaactgacttcagcaaagtgtttcatgggaatgagtctctctggaagaacttcaaggaacatcatcagctgcagaggattggggagtcagaggactgtgcaggaatcgtgtccttcctgtgctctccagatgccagctacgtcaacggggagaacattgcggtggcaggctactccactcggctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tubulin tyrosine ligase-like family, member 5 - insulin-like growth factor binding protein 5 - family with sequence similarity 44, member A - MU-2/AP1M2 domain containing, death-inducing |