TSPYL4-TSPY-like 4 Gene View larger

TSPYL4-TSPY-like 4 Gene

PTXBC009116

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSPYL4-TSPY-like 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TSPYL4-TSPY-like 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009116
Product type: DNA & cDNA
Ncbi symbol: TSPYL4
Origin species: Human
Product name: TSPYL4-TSPY-like 4 Gene
Size: 2ug
Accessions: BC009116
Gene id: 23270
Gene description: TSPY-like 4
Synonyms: dJ486I3.2; testis-specific Y-encoded-like protein 4; TSPY-like protein 4; TSPY like 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggactcactggaggccatcgatcaagagttgtcaaacgtaaatgcccaggctgacagggccttccttcagcttgagcgcaagtttggccgcatgcgaaggctccacatgcagcgcagaagtttcattatccagaatatcccaggtttctgggttactgcctttcgaaaccacccccagctgtcacctatgatcagtggccaagatgaagacatgctgaggtacatgatcaatttggaggtggaggagcttaaacaccccagagcaggctgcaaattcaagttcatctttcagggcaacccctacttccgaaatgaggggcttgtcaaggaatatgaacgcagatcctctggccgggtggtgtctctttccactccaatccgctggcaccgaggccaagacccccaggctcatatccacagaaaccgggaagggaacactatccctagtttcttcaactggttttcagaccacagccttctagaattcgacagaattgcagagattatcaaaggagaactgtggcccaatcccctacaatactacctgatgggtgaagggccccgtagaggaattcgaggcccaccaaggcagccagtggagagcgccagatccttcaggttccagtctggctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tropomyosin 3
- tropomyosin 4
- HHIP-like 2
- CD27 molecule

Buy TSPYL4-TSPY-like 4 Gene now

Add to cart