Cart 55 Product Products 16 211,29 € (empty)
-
-
-
-
-
-
-
-
-
-
-
1 x DLEU1-dele...113,40 € -
-
-
-
-
-
-
-
-
-
-
1 x C7orf59-ch...113,40 € -
-
-
-
-
-
1 x OCC-1-over...113,40 € -
1 x REG3G-rege...113,40 € -
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
No products
To be determined Shipping
16 211,29 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 55 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 16 211,29 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 16 211,29 €
Data sheet of TPM3-tropomyosin 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TPM3-tropomyosin 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000771 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TPM3 |
| Origin species: | Human |
| Product name: | TPM3-tropomyosin 3 Gene |
| Size: | 2ug |
| Accessions: | BC000771 |
| Gene id: | 7170 |
| Gene description: | tropomyosin 3 |
| Synonyms: | CAPM1; CFTD; HEL-189; HEL-S-82p; NEM1; OK/SW-cl.5; TM-5; TM3; TM30; TM30nm; TM5; TPMsk3; TRK; hscp30; tropomyosin alpha-3 chain; alpha-tropomyosin, slow skeletal; cytoskeletal tropomyosin TM30; epididymis luminal protein 189; epididymis secretory sperm binding protein Li 82p; heat-stable cytoskeletal protein 30 kDa; tropomyosin gamma; tropomyosin-5; tropomyosin 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgggatcaccaccatcgaggcggtgaagcgcaagatccaggttctgcagcagcaggcagatgatgcagaggagcgagctgagcgcctccagcgagaagttgagggagaaaggcgggcccgggaacaggctgaggctgaggtggcctccttgaaccgtaggatccagctggttgaagaagagctggaccgtgctcaggagcgcctggccactgccctgcaaaagctggaagaagctgaaaaagctgctgatgagagtgagagaggtatgaaggttattgaaaaccgggccttaaaagatgaagaaaagatggaactccaggaaatccaactcaaagaagctaagcacattgcagaagaggcagataggaagtatgaagaggtggctcgtaagttggtgatcattgaaggagacttggaacgcacagaggaacgagctgagctggcagagtcccgttgccgagagatggatgagcagattagactgatggaccagaacctgaagtgtctgagtgctgctgaagaaaagtactctcaaaaagaagataaatatgaggaagaaatcaagattcttactgataaactcaaggaggcagagacccgtgctgagtttgctgagagatcggtagccaagctggaaaagacaattgatgacctggaagataaactgaaatgcaccaaagaggagcacctctgtacacaaaggatgctggaccagaccctgcttgacctgaatgagatgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tropomyosin 4 - HHIP-like 2 - CD27 molecule - synaptoporin |