TPM3-tropomyosin 3 Gene View larger

TPM3-tropomyosin 3 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TPM3-tropomyosin 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TPM3-tropomyosin 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000771
Product type: DNA & cDNA
Ncbi symbol: TPM3
Origin species: Human
Product name: TPM3-tropomyosin 3 Gene
Size: 2ug
Accessions: BC000771
Gene id: 7170
Gene description: tropomyosin 3
Synonyms: CAPM1; CFTD; HEL-189; HEL-S-82p; NEM1; OK/SW-cl.5; TM-5; TM3; TM30; TM30nm; TM5; TPMsk3; TRK; hscp30; tropomyosin alpha-3 chain; alpha-tropomyosin, slow skeletal; cytoskeletal tropomyosin TM30; epididymis luminal protein 189; epididymis secretory sperm binding protein Li 82p; heat-stable cytoskeletal protein 30 kDa; tropomyosin gamma; tropomyosin-5; tropomyosin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgggatcaccaccatcgaggcggtgaagcgcaagatccaggttctgcagcagcaggcagatgatgcagaggagcgagctgagcgcctccagcgagaagttgagggagaaaggcgggcccgggaacaggctgaggctgaggtggcctccttgaaccgtaggatccagctggttgaagaagagctggaccgtgctcaggagcgcctggccactgccctgcaaaagctggaagaagctgaaaaagctgctgatgagagtgagagaggtatgaaggttattgaaaaccgggccttaaaagatgaagaaaagatggaactccaggaaatccaactcaaagaagctaagcacattgcagaagaggcagataggaagtatgaagaggtggctcgtaagttggtgatcattgaaggagacttggaacgcacagaggaacgagctgagctggcagagtcccgttgccgagagatggatgagcagattagactgatggaccagaacctgaagtgtctgagtgctgctgaagaaaagtactctcaaaaagaagataaatatgaggaagaaatcaagattcttactgataaactcaaggaggcagagacccgtgctgagtttgctgagagatcggtagccaagctggaaaagacaattgatgacctggaagataaactgaaatgcaccaaagaggagcacctctgtacacaaaggatgctggaccagaccctgcttgacctgaatgagatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tropomyosin 4
- HHIP-like 2
- CD27 molecule
- synaptoporin

Buy TPM3-tropomyosin 3 Gene now

Add to cart