HHIPL2-HHIP-like 2 Gene View larger

HHIPL2-HHIP-like 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HHIPL2-HHIP-like 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HHIPL2-HHIP-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015201
Product type: DNA & cDNA
Ncbi symbol: HHIPL2
Origin species: Human
Product name: HHIPL2-HHIP-like 2 Gene
Size: 2ug
Accessions: BC015201
Gene id: 79802
Gene description: HHIP-like 2
Synonyms: KIAA1822L; HHIP-like protein 2; hedgehog interacting protein-like 2; HHIP like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggcccaagatcctcagggctgcctgcagctctgcctgagcgaggtggccaacgggctgaggaaccccgtctccatggtccatgctggggacggcacccatcgcttctttgttgccgagcaggtaggagtggtgtgggtctacctccctgatgggagtcgcctggagcaacccttcctggacctcaagaacatcgtgttgaccaccccatggatcggggatgagagaggcttcttggggttggcttttcaccccaaattccgccacaatcgcaagttctatatttattattcgtgcctggacaagaagaaggtagaaaagatccgaattagtgagatgaaggtttctcgggctgatcctaacaaagctgacctgaaatcagagagggtcatcttggagattgaagaaccagcctcaaaccataatggcggacaacttctttttggcctggatggctatatgtacatattcactggggacgggggacaggctggagatccctttggcctgtttggaaatgctcagaacaaaagttccctgctgggaaaagttttaaggatcgatgtgaacagggcaggctcacatggcaagcggtaccgagtcccctcggacaatccatttgtttctgagccaggggcccaccccgccatctatgcctatgggatcaggaacatgtggcgttgtgctgtggaccgaggggaccccatcacgcgccagggccgaggccggatattctgtggggacgtgggccagaacaggtttgaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CD27 molecule
- synaptoporin
- CD82 molecule
- CD38 molecule

Buy HHIPL2-HHIP-like 2 Gene now

Add to cart