CD27-CD27 molecule Gene View larger

CD27-CD27 molecule Gene

PTXBC012160

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD27-CD27 molecule Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CD27-CD27 molecule Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012160
Product type: DNA & cDNA
Ncbi symbol: CD27
Origin species: Human
Product name: CD27-CD27 molecule Gene
Size: 2ug
Accessions: BC012160
Gene id: 939
Gene description: CD27 molecule
Synonyms: CD27 molecule; T-cell activation antigen CD27; CD27 antigen; S152; S152. LPFS2; T14; TNFRSF7; Tp55; CD27L receptor; T cell activation antigen S152; tumor necrosis factor receptor superfamily, member 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacggccacatccctggtggctgtgcgttctggggaccctggtggggctctcagctactccagcccccaagagctgcccagagaggcactactgggctcagggaaagctgtgctgccagatgtgtgagccaggaacattcctcgtgaaggactgtgaccagcatagaaaggctgctcagtgtgatccttgcataccgggggtctccttctctcctgaccaccacacccggccccactgtgagagctgtcggcactgtaactctggtcttctcgttcgcaactgcaccatcactgccaatgctgagtgtgcctgtcgcaatggctggcagtgcagggacaaggagtgcaccgagtgtgatcctcttccaaacccttcgctgaccgctcggtcgtctcaggccctgagcccacaccctcagcccacccacttaccttatgtcagtgagatgctggaggccaggacagctgggcacatgcagactctggctgacttcaggcagctgcctgcccggactctctctacccactggccaccccaaagatccctgtgcagctccgattttattcgcatccttgtgatcttctctggaatgttccttgttttcaccctggccggggccctgttcctccatcaacgaaggaaatatagatcaaacaaaggagaaagtcctgtggagcctgcagagccttgtcgttacagctgccccagggaggaggagggcagcaccatccccatccaggaggattaccgaaaaccggagcctgcctgctccccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - synaptoporin
- CD82 molecule
- CD38 molecule
- CD47 molecule

Buy CD27-CD27 molecule Gene now

Add to cart