Login to display prices
Login to display prices
CD27-CD27 molecule Gene View larger

CD27-CD27 molecule Gene

PTXBC012160

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD27-CD27 molecule Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CD27-CD27 molecule Gene

Proteogenix catalog: PTXBC012160
Ncbi symbol: CD27
Product name: CD27-CD27 molecule Gene
Size: 2ug
Accessions: BC012160
Gene id: 939
Gene description: CD27 molecule
Synonyms: CD27 molecule; T-cell activation antigen CD27; CD27 antigen; S152; S152. LPFS2; T14; TNFRSF7; Tp55; CD27L receptor; T cell activation antigen S152; tumor necrosis factor receptor superfamily, member 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacggccacatccctggtggctgtgcgttctggggaccctggtggggctctcagctactccagcccccaagagctgcccagagaggcactactgggctcagggaaagctgtgctgccagatgtgtgagccaggaacattcctcgtgaaggactgtgaccagcatagaaaggctgctcagtgtgatccttgcataccgggggtctccttctctcctgaccaccacacccggccccactgtgagagctgtcggcactgtaactctggtcttctcgttcgcaactgcaccatcactgccaatgctgagtgtgcctgtcgcaatggctggcagtgcagggacaaggagtgcaccgagtgtgatcctcttccaaacccttcgctgaccgctcggtcgtctcaggccctgagcccacaccctcagcccacccacttaccttatgtcagtgagatgctggaggccaggacagctgggcacatgcagactctggctgacttcaggcagctgcctgcccggactctctctacccactggccaccccaaagatccctgtgcagctccgattttattcgcatccttgtgatcttctctggaatgttccttgttttcaccctggccggggccctgttcctccatcaacgaaggaaatatagatcaaacaaaggagaaagtcctgtggagcctgcagagccttgtcgttacagctgccccagggaggaggagggcagcaccatccccatccaggaggattaccgaaaaccggagcctgcctgctccccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: