CD47-CD47 molecule Gene View larger

CD47-CD47 molecule Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD47-CD47 molecule Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CD47-CD47 molecule Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010016
Product type: DNA & cDNA
Ncbi symbol: CD47
Origin species: Human
Product name: CD47-CD47 molecule Gene
Size: 2ug
Accessions: BC010016
Gene id: 961
Gene description: CD47 molecule
Synonyms: CD47 molecule; CD47 glycoprotein; CD47 antigen (Rh-related antigen, integrin-associated signal transducer); leukocyte surface antigen CD47; IAP; MER6; OA3; Rh-related antigen; antigen identified by monoclonal antibody 1D8; antigenic surface determinant protein OA3; integrin associated protein; integrin-associated signal transducer
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggcccctggtagcggcgctgttgctgggctcggcgtgctgcggatcagctcagctactatttaataaaacaaaatctgtagaattcacgttttgtaatgacactgtcgtcattccatgctttgttactaatatggaggcacaaaacactactgaagtatacgtaaagtggaaatttaaaggaagagatatttacacctttgatggagctctaaacaagtccactgtccccactgactttagtagtgcaaaaattgaagtctcacaattactaaaaggagatgcctctttgaagatggataagagtgatgctgtctcacacacaggaaactacacttgtgaagtaacagaattaaccagagaaggtgaaacgatcatcgagctaaaatatcgtgttgtttcatggttttctccaaatgaaaatattcttattgttattttcccaatttttgctatactcctgttctggggacagtttggtattaaaacacttaaatatagatccggtggtatggatgagaaaacaattgctttacttgttgctggactagtgatcactgtcattgtcattgttggagccattcttttcgtcccaggtgaatattcattaaagaatgctactggccttggtttaattgtgacttctacagggatattaatattacttcactactatgtgtttagtacagcgattggattaacctccttcgtcattgccatattggttattcaggtgatagcctatatcctcgctgtggttggactgagtctctgtattgcggcgtgtataccaatgcatggccctcttctgatttcaggtttgagtatcttagctctagcacaattacttggactagtttatatgaaatttgtggcttccaatcagaagactatacaacctcctaggaataactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - uroplakin 3B
- annexin A10
- CD68 molecule
- CD72 molecule

Buy CD47-CD47 molecule Gene now

Add to cart