TPM4-tropomyosin 4 Gene View larger

TPM4-tropomyosin 4 Gene

PTXBC002827

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TPM4-tropomyosin 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TPM4-tropomyosin 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002827
Product type: DNA & cDNA
Ncbi symbol: TPM4
Origin species: Human
Product name: TPM4-tropomyosin 4 Gene
Size: 2ug
Accessions: BC002827
Gene id: 7171
Gene description: tropomyosin 4
Synonyms: HEL-S-108; tropomyosin alpha-4 chain; TM30p1; epididymis secretory protein Li 108; tropomyosin 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccggcctcaactccctggaggcggtgaaacgcaagatccaggccctgcagcagcaggcggacgaggcggaagaccgcgcgcagggcctgcagcgggagctggacggcgagcgcgagcggcgcgagaaagctgaaggtgatgtggccgccctcaaccgacgcatccagctctttgaggaggagttggacagggctcaggaacgactggccacggccctgcagaagctggaggaggcagaaaaagctgcagatgagagtgagagaggaatgaaggtgatagaaaaccgggccatgaaggatgaggagaagatggagattcaggagatgcagctcaaagaggccaagcacattgcggaagaggctgaccgcaaatacgaggaggtagctcgtaagctggtcatcctggagggtgagctggagagggcagaggagcgtgcggaggtgtctgaactaaaatgtggtgacctggaagaagaactcaagaatgttactaacaatctgaaatctctggaggctgcatctgaaaagtattctgaaaaggaggacaaatatgaagaagaaattaaacttctgtctgacaaactgaaagaggctgagacccgtgctgaatttgcagagagaacggttgcaaaactggaaaagacaattgatgacctggaagagaaacttgcccaggccaaagaagagaacgtgggcttacatcagacactggatcagacactaaacgaacttaactgtatataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - HHIP-like 2
- CD27 molecule
- synaptoporin
- CD82 molecule

Buy TPM4-tropomyosin 4 Gene now

Add to cart