Login to display prices
Login to display prices
ARHGDIA-Rho GDP dissociation inhibitor (GDI) alpha Gene View larger

ARHGDIA-Rho GDP dissociation inhibitor (GDI) alpha Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARHGDIA-Rho GDP dissociation inhibitor (GDI) alpha Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ARHGDIA-Rho GDP dissociation inhibitor (GDI) alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005851
Product type: DNA & cDNA
Ncbi symbol: ARHGDIA
Origin species: Human
Product name: ARHGDIA-Rho GDP dissociation inhibitor (GDI) alpha Gene
Size: 2ug
Accessions: BC005851
Gene id: 396
Gene description: Rho GDP dissociation inhibitor (GDI) alpha
Synonyms: GDIA1; HEL-S-47e; NPHS8; RHOGDI-1; rho GDP-dissociation inhibitor 1; GDP-dissociation inhibitor, aplysia RAS-related 1; Rho GDP dissociation inhibitor (GDI) alpha; epididymis secretory sperm binding protein Li 47e; Rho GDP dissociation inhibitor alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgagcaggagcccacagccgagcagctggcccagattgcagcggagaacgaggaggatgagcactcggtcaactacaagcccccggcccagaagagcatccaggagatccaggagctggacaaggacgacgagagcctgcgaaagtacaaggaggccctgctgggccgcgtggccgtttccgcagaccccaacgtccccaacgtcgtggtgactggcctgaccctggtgtgcagctcggccccgggccccctggagctggacctgacgggcgacctggagagcttcaagaagcagtcgtttgtgctgaaggagggtgtggagtaccggataaaaatctctttccgggttaaccgagagatagtgtccggcatgaagtacatccagcatacgtacaggaaaggcgtcaagattgacaagactgactacatggtaggcagctatgggccccgggccgaggagtacgagttcctgacccccgtggaggaggcacccaagggtatgctggcccggggcagctacagcatcaagtcccgcttcacagacgacgacaagaccgaccacctgtcctgggagtggaatctcaccatcaagaaggactggaaggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DnaJ (Hsp40) homolog, subfamily A, member 4
- receptor (chemosensory) transporter protein 4
- complement component 4 binding protein, beta
- palate, lung and nasal epithelium associated