Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RTP4-receptor (chemosensory) transporter protein 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RTP4-receptor (chemosensory) transporter protein 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013161 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RTP4 |
| Origin species: | Human |
| Product name: | RTP4-receptor (chemosensory) transporter protein 4 Gene |
| Size: | 2ug |
| Accessions: | BC013161 |
| Gene id: | 64108 |
| Gene description: | receptor (chemosensory) transporter protein 4 |
| Synonyms: | IFRG28; Z3CXXC4; receptor-transporting protein 4; 28 kDa interferon-responsive protein; 28kD interferon responsive protein; 3CxxC-type zinc finger protein 4; receptor (chemosensory) transporter protein 4; zinc finger, 3CxxC-type 4; receptor transporter protein 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttgtagatttctggacttgggagcagacatttcaagaactaatccaagaggcaaaaccccgggccacatggacgctgaagttggatggcaaccttcagctagactgcctggctcaagggtggaagcaataccaacagagagcatttggctggttccggtgttcctcctgccagcgaagttgggcttccgcccaagtgcagattctgtgccacacgtactgggagcactggacatcccagggtcaggtgcgtatgaggctctttggccaaaggtgccagaagtgctcctggtcccaatatgagatgcctgagttctcctcggatagcaccatgaggattctgagcaacctggtgcagcatatactgaagaaatactatggaaatggcatgaggaagtctccagaaatgccagtaatcctggaagtgtccctggaaggatcccatgacacagccaattgtgaggcatgcactttgggcatatgtggacagggcttaaaaagctacatgacaaagccgtccaaatccctactcccccacctaaagactgggaattcctcacctggaattggtgctgtgtacctcgcaaaccaagccaagaaccagtcagatgaggcaaaagaggctaaggggagtgggtatgagaaattagggcccagtcgagacccagatccactgaacatctgtgtctttattttgctgcttgtatttattgtagtcaaatgctttacatcagaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - complement component 4 binding protein, beta - palate, lung and nasal epithelium associated - phosphatidylinositol transfer protein, beta - hydroxysteroid (17-beta) dehydrogenase 11 |