Login to display prices
Login to display prices
RTP4-receptor (chemosensory) transporter protein 4 Gene View larger

RTP4-receptor (chemosensory) transporter protein 4 Gene

PTXBC013161

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RTP4-receptor (chemosensory) transporter protein 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RTP4-receptor (chemosensory) transporter protein 4 Gene

Proteogenix catalog: PTXBC013161
Ncbi symbol: RTP4
Product name: RTP4-receptor (chemosensory) transporter protein 4 Gene
Size: 2ug
Accessions: BC013161
Gene id: 64108
Gene description: receptor (chemosensory) transporter protein 4
Synonyms: IFRG28; Z3CXXC4; receptor-transporting protein 4; 28 kDa interferon-responsive protein; 28kD interferon responsive protein; 3CxxC-type zinc finger protein 4; receptor (chemosensory) transporter protein 4; zinc finger, 3CxxC-type 4; receptor transporter protein 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttgtagatttctggacttgggagcagacatttcaagaactaatccaagaggcaaaaccccgggccacatggacgctgaagttggatggcaaccttcagctagactgcctggctcaagggtggaagcaataccaacagagagcatttggctggttccggtgttcctcctgccagcgaagttgggcttccgcccaagtgcagattctgtgccacacgtactgggagcactggacatcccagggtcaggtgcgtatgaggctctttggccaaaggtgccagaagtgctcctggtcccaatatgagatgcctgagttctcctcggatagcaccatgaggattctgagcaacctggtgcagcatatactgaagaaatactatggaaatggcatgaggaagtctccagaaatgccagtaatcctggaagtgtccctggaaggatcccatgacacagccaattgtgaggcatgcactttgggcatatgtggacagggcttaaaaagctacatgacaaagccgtccaaatccctactcccccacctaaagactgggaattcctcacctggaattggtgctgtgtacctcgcaaaccaagccaagaaccagtcagatgaggcaaaagaggctaaggggagtgggtatgagaaattagggcccagtcgagacccagatccactgaacatctgtgtctttattttgctgcttgtatttattgtagtcaaatgctttacatcagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: