RTP4-receptor (chemosensory) transporter protein 4 Gene View larger

RTP4-receptor (chemosensory) transporter protein 4 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RTP4-receptor (chemosensory) transporter protein 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RTP4-receptor (chemosensory) transporter protein 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013161
Product type: DNA & cDNA
Ncbi symbol: RTP4
Origin species: Human
Product name: RTP4-receptor (chemosensory) transporter protein 4 Gene
Size: 2ug
Accessions: BC013161
Gene id: 64108
Gene description: receptor (chemosensory) transporter protein 4
Synonyms: IFRG28; Z3CXXC4; receptor-transporting protein 4; 28 kDa interferon-responsive protein; 28kD interferon responsive protein; 3CxxC-type zinc finger protein 4; receptor (chemosensory) transporter protein 4; zinc finger, 3CxxC-type 4; receptor transporter protein 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttgtagatttctggacttgggagcagacatttcaagaactaatccaagaggcaaaaccccgggccacatggacgctgaagttggatggcaaccttcagctagactgcctggctcaagggtggaagcaataccaacagagagcatttggctggttccggtgttcctcctgccagcgaagttgggcttccgcccaagtgcagattctgtgccacacgtactgggagcactggacatcccagggtcaggtgcgtatgaggctctttggccaaaggtgccagaagtgctcctggtcccaatatgagatgcctgagttctcctcggatagcaccatgaggattctgagcaacctggtgcagcatatactgaagaaatactatggaaatggcatgaggaagtctccagaaatgccagtaatcctggaagtgtccctggaaggatcccatgacacagccaattgtgaggcatgcactttgggcatatgtggacagggcttaaaaagctacatgacaaagccgtccaaatccctactcccccacctaaagactgggaattcctcacctggaattggtgctgtgtacctcgcaaaccaagccaagaaccagtcagatgaggcaaaagaggctaaggggagtgggtatgagaaattagggcccagtcgagacccagatccactgaacatctgtgtctttattttgctgcttgtatttattgtagtcaaatgctttacatcagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - complement component 4 binding protein, beta
- palate, lung and nasal epithelium associated
- phosphatidylinositol transfer protein, beta
- hydroxysteroid (17-beta) dehydrogenase 11

Buy RTP4-receptor (chemosensory) transporter protein 4 Gene now

Add to cart