Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PLUNC-palate, lung and nasal epithelium associated Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLUNC-palate, lung and nasal epithelium associated Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012549 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLUNC |
| Origin species: | Human |
| Product name: | PLUNC-palate, lung and nasal epithelium associated Gene |
| Size: | 2ug |
| Accessions: | BC012549 |
| Gene id: | 51297 |
| Gene description: | palate, lung and nasal epithelium associated |
| Synonyms: | protein Plunc; PLUNC; LUNX; NASG; SPLUNC1; SPURT; bA49G10.5; BPI fold-containing family A member 1; ligand-binding protein RYA3; lung-specific protein X; nasopharyngeal carcinoma-related protein; palate lung and nasal epithelium clone protein; palate, lung and nasal epithelium associated; secretory protein in upper respiratory tracts; short PLUNC1; tracheal epithelium enriched protein; von Ebner protein Hl; BPI fold containing family A member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtttcaaactgggggcctcattgtcttctacgggctgttagcccagaccatggcccagtttggaggcctgcccgtgcccctggaccagaccctgcccttgaatgtgaatccagccctgcccttgagtcccacaggtcttgcaggaagcttgacaaatgccctcagcaatggcctgctgtctgggggcctgttgggcattctggaaaaccttccgctcctggacatcctgaagcctggaggaggtacttctggtggcctccttgggggactgcttggaaaagtgacgtcagtgattcctggcctgaacaacatcattgacataaaggtcactgacccccagctgctggaacttggccttgtgcagagccctgatggccaccgtctctatgtcaccatccctctcggcataaagctccaagtgaatacgcccctggtcggtgcaagtctgttgaggctggctgtgaagctggacatcactgcagaaatcttagctgtgagagataagcaggagaggatccacctggtccttggtgactgcacccattcccctggaagcctgcaaatttctctgcttgatggacttggccccctccccattcaaggtcttctggacagcctcacagggatcttgaataaagtcctgcctgagttggttcagggcaacgtgtgccctctggtcaatgaggttctcagaggcttggacatcaccctggtgcatgacattgttaacatgctgatccacggactacagtttgtcatcaaggtctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphatidylinositol transfer protein, beta - hydroxysteroid (17-beta) dehydrogenase 11 - alkB, alkylation repair homolog 4 (E. coli) - mitochondrial carrier homolog 2 (C. elegans) |