Login to display prices
Login to display prices
ALKBH4-alkB, alkylation repair homolog 4 (E. coli) Gene View larger

ALKBH4-alkB, alkylation repair homolog 4 (E. coli) Gene

PTXBC002820

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ALKBH4-alkB, alkylation repair homolog 4 (E. coli) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ALKBH4-alkB, alkylation repair homolog 4 (E. coli) Gene

Proteogenix catalog: PTXBC002820
Ncbi symbol: ALKBH4
Product name: ALKBH4-alkB, alkylation repair homolog 4 (E. coli) Gene
Size: 2ug
Accessions: BC002820
Gene id: 54784
Gene description: alkB, alkylation repair homolog 4 (E. coli)
Synonyms: ABH4; alpha-ketoglutarate-dependent dioxygenase alkB homolog 4; alkB homolog 4, lysine demthylase; alkB, alkylation repair homolog 4; alkylated DNA repair protein alkB homolog 4; alkB homolog 4, lysine demethylase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggctgccgccgagacccccgaagtccttcgggaatgcggttgcaagggcatccggacctgtctgatctgcgagcggcagcgcggcagtgacccgccctgggagctgcccccagcgaaaacataccgtttcatttactgctccgacaccggctgggccgtgggcacagaggagtctgactttgagggctgggccttccccttcccaggagtgatgctgatcgaggactttgtgacccgggaggaagaagccgagttggtgcggctcatggaccgtgacccctggaagctctcccagtctggacggaggaagcaggactatggccccaaagtcaactttcggaaacagaagctaaagaccgagggcttctgcggcctccccagcttcagccgggaggtggtgcggaggatgggcctctacccggggctggagggcttccggcccgtcgagcagtgcaacctggactactgccccgagcggggctctgccattgacccccacctggacgacgcctggctgtggggggagcggctggtcagcctcaacctcctgtcccccaccgtgctgtccatgtgtcgggaggcgcccgggagcctgctcctctgctcggccccgtcggctgccccggaggccttggtggacagcgtgatagcacccagccggtcggtgctatgccaggaggtggaggtggccatccccttacccgcccgctccctgctggtcctcaccggggcggcacggcaccagtggaagcatgccatccaccgcagacacatcgaggcccgccgcgtctgcgtcactttccgggagctgtcggctgagtttggccctggagggaggcagcaagagctgggccaggaactgctgcggatcgccctctccttccagggaagacccgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: