MORG1-mitogen-activated protein kinase organizer 1 Gene View larger

MORG1-mitogen-activated protein kinase organizer 1 Gene

PTXBC005870

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MORG1-mitogen-activated protein kinase organizer 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MORG1-mitogen-activated protein kinase organizer 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005870
Product type: DNA & cDNA
Ncbi symbol: MORG1
Origin species: Human
Product name: MORG1-mitogen-activated protein kinase organizer 1 Gene
Size: 2ug
Accessions: BC005870
Gene id: 84292
Gene description: mitogen-activated protein kinase organizer 1
Synonyms: MORG1; WD repeat domain-containing protein 83; MAPK organizer 1; mitogen-activated protein kinase organizer 1; WD repeat domain 83
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctttccctgagccaaagccgcggcctccagagctgccgcagaaacggttgaagacgctggactgcgggcagggggcagtgcgagccgtacgatttaatgtggatggcaattactgcctgacgtgcggcagtgacaagacgctgaagctgtggaacccgcttcgggggacgctgctgcggacgtacagcggccacggctacgaggtgctggatgcggccggctcctttgacaacagtagtctctgctccggcggcggggacaaggcggtggttctgtgggatgtggcatcagggcaggtcgtgcgcaaattccggggccacgcagggaaggtgaacacggtgcagtttaatgaagaggccacagttatcctgtccggctctattgattccagtatccgctgttgggattgccgctcacggaggcctgagccagtgcagacgctggatgaggccagagatggcgtgtccagtgtgaaggtgtcagaccacgagatcctggcaggctccgtggatggccgcgtgagacgctatgacctaaggatggggcagctcttctcagactacgtgggcagccccatcacctgcacctgcttcagccgggatgggcagtgcaccctggtgtccagcctggactccacattgcggctcctggacaaagacacaggggagctgctgggcgagtacaagggccataagaaccaggaatacaagctggactgctgcctgagcgagcgtgacacacatgtggtcagctgttctgaggacgggaaggtgttcttctgggacctggtggagggtgcgctggctctggccctgcctgtgggttccggtgtggtgcagtcgctggcctaccacccaacagagccctgcctgctgaccgccatgggaggcagcgtccagtgctggcgagaggaggcctatgaggcagaggatggagcaggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - heterogeneous nuclear ribonucleoprotein A1
- tissue specific transplantation antigen P35B
- V-set and immunoglobulin domain containing 2
- major histocompatibility complex, class I, G

Buy MORG1-mitogen-activated protein kinase organizer 1 Gene now

Add to cart