VSIG2-V-set and immunoglobulin domain containing 2 Gene View larger

VSIG2-V-set and immunoglobulin domain containing 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VSIG2-V-set and immunoglobulin domain containing 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about VSIG2-V-set and immunoglobulin domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007313
Product type: DNA & cDNA
Ncbi symbol: VSIG2
Origin species: Human
Product name: VSIG2-V-set and immunoglobulin domain containing 2 Gene
Size: 2ug
Accessions: BC007313
Gene id: 23584
Gene description: V-set and immunoglobulin domain containing 2
Synonyms: 2210413P10Rik; CTH; CTXL; V-set and immunoglobulin domain-containing protein 2; CT-like protein; cortical thymocyte receptor (X. laevis CTX) like; cortical thymocyte-like protein; V-set and immunoglobulin domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgagctcccggggccctttctctgcggggccctgctaggcttcctgtgcctgagtgggctggccgtggaggtgaaggtacccacagagccgctgagcacgcccctggggaagacagccgagctgacctgcacctacagcacgtcggtgggagacagcttcgccctggagtggagctttgtgcagcctgggaaacccatctctgagtcccatccaatcctgtacttcaccaatggccatctgtatccaactggttctaagtcaaagcgggtcagcctgcttcagaacccccccacagtgggggtggccacactgaaactgactgacgtccacccctcagatactggaacctacctctgccaagtcaacaacccaccagatttctacaccaatgggttggggctaatcaaccttactgtgctggttccccccagtaatcccttatgcagtcagagtggacaaacctctgtgggaggctctactgcactgagatgcagctcttccgagggggctcctaagccagtgtacaactgggtgcgtcttggaacttttcctacaccttctcctggcagcatggttcaagatgaggtgtctggccagctcattctcaccaacctctccctgacctcctcgggcacctaccgctgtgtggccaccaaccagatgggcagtgcatcctgtgagctgaccctctctgtgaccgaaccctcccaaggccgagtggccggagctctgattggggtgctcctgggcgtgctgttgctgtcagttgctgcgttctgcctggtcaggttccagaaagagagggggaagaagcccaaggagacatatgggggtagtgaccttcgggaggatgccatcgctcctgggatctctgagcacacttgtatgagggctgattctagcaaggggttcctggaaagaccctcgtctgccagcaccgtgacgaccaccaagtccaagctccctatggtcgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - major histocompatibility complex, class I, G
- replication factor C (activator 1) 5, 36.5kDa
- quaking homolog, KH domain RNA binding (mouse)
- major histocompatibility complex, class I, B

Buy VSIG2-V-set and immunoglobulin domain containing 2 Gene now

Add to cart