Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HLA-B-major histocompatibility complex, class I, B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HLA-B-major histocompatibility complex, class I, B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013187 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HLA-B |
| Origin species: | Human |
| Product name: | HLA-B-major histocompatibility complex, class I, B Gene |
| Size: | 2ug |
| Accessions: | BC013187 |
| Gene id: | 3106 |
| Gene description: | major histocompatibility complex, class I, B |
| Synonyms: | MHC class I antigen HLA-B heavy chain; MHC class I antigen HLA-B alpha chain; MHC HLA-B transmembrane glycoprotein; MHC HLA-B cell surface glycoprotein; HLA class I antigen HLA-B; B-4901; HLAB; major histocompatibility complex, class I, B; HLA class I histocompatibility antigen, B alpha chain; MHC class 1 antigen; MHC class I antigen SHCHA; MHC class I molecule; leukocyte antigen class I-B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgggtcacggcgccccgaaccgtcctcctgctgctctcgggagccctggccctgaccgagacctgggccggctcccactccatgaggtatttctacaccgccatgtcccggcccggccgcggggagccccgcttcatctcagtgggctacgtggacgacacgcagttcgtgaggttcgacagcgacgccgcgagtccgagagaggagccgcgggcgccgtggatagagcaggaggggccggagtattgggaccggaacacacagatctgcaagaccaacacacagacttaccgagagagcctgcggaacctgcgcggctactacaaccagagcgaggccgggtctcacaccctccagaggatgtacggctgcgacgtggggccggacgggcgcctcctccgcgggcatgaccagtacgcctacgacggcaaggattacatcgccctgaacgaggacctgagctcctggaccgcggcggacacggcggctcagatcacccagcgcaagtgggaggcggcccgtgaggcggagcagctgagagcctacctggagggcctgtgcgtggagtggctccgcagatacctggagaacgggaaggagacgctgcagcgcgcggaccccccaaagacacatgtgacccaccaccccatctctgaccatgaggccaccctgaggtgctgggccctgggcttctaccctgcggagatcacactgacctggcagcgggatggcgaggaccaaactcaggacaccgagcttgtggagaccagaccagcaggagatagaaccttccagaagtgggcagctgtggtggtgccttctggagaagagcagagatacacatgccatgtacagcatgaggggctgccgaagcccctcaccctgagatgggagccatcttcccagtccaccatccccatcgtgggcattgttgctggcctggctgtcctagcagttgtggtcatcggagctgtggtcgctactgtgatgtgtaggaggaagagctcaggtggaaaaggagggagctactctcaggctgcgtccagcgacagtgcccagggctctgatgtgtctctcacagcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - major histocompatibility complex, class I, A - major histocompatibility complex, class I, C - phosphatase and tensin homolog pseudogene 1 - aldehyde dehydrogenase 3 family, member B2 |