Login to display prices
Login to display prices
HLA-B-major histocompatibility complex, class I, B Gene View larger

HLA-B-major histocompatibility complex, class I, B Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-B-major histocompatibility complex, class I, B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-B-major histocompatibility complex, class I, B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013187
Product type: DNA & cDNA
Ncbi symbol: HLA-B
Origin species: Human
Product name: HLA-B-major histocompatibility complex, class I, B Gene
Size: 2ug
Accessions: BC013187
Gene id: 3106
Gene description: major histocompatibility complex, class I, B
Synonyms: MHC class I antigen HLA-B heavy chain; MHC class I antigen HLA-B alpha chain; MHC HLA-B transmembrane glycoprotein; MHC HLA-B cell surface glycoprotein; HLA class I antigen HLA-B; B-4901; HLAB; major histocompatibility complex, class I, B; HLA class I histocompatibility antigen, B alpha chain; MHC class 1 antigen; MHC class I antigen SHCHA; MHC class I molecule; leukocyte antigen class I-B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgggtcacggcgccccgaaccgtcctcctgctgctctcgggagccctggccctgaccgagacctgggccggctcccactccatgaggtatttctacaccgccatgtcccggcccggccgcggggagccccgcttcatctcagtgggctacgtggacgacacgcagttcgtgaggttcgacagcgacgccgcgagtccgagagaggagccgcgggcgccgtggatagagcaggaggggccggagtattgggaccggaacacacagatctgcaagaccaacacacagacttaccgagagagcctgcggaacctgcgcggctactacaaccagagcgaggccgggtctcacaccctccagaggatgtacggctgcgacgtggggccggacgggcgcctcctccgcgggcatgaccagtacgcctacgacggcaaggattacatcgccctgaacgaggacctgagctcctggaccgcggcggacacggcggctcagatcacccagcgcaagtgggaggcggcccgtgaggcggagcagctgagagcctacctggagggcctgtgcgtggagtggctccgcagatacctggagaacgggaaggagacgctgcagcgcgcggaccccccaaagacacatgtgacccaccaccccatctctgaccatgaggccaccctgaggtgctgggccctgggcttctaccctgcggagatcacactgacctggcagcgggatggcgaggaccaaactcaggacaccgagcttgtggagaccagaccagcaggagatagaaccttccagaagtgggcagctgtggtggtgccttctggagaagagcagagatacacatgccatgtacagcatgaggggctgccgaagcccctcaccctgagatgggagccatcttcccagtccaccatccccatcgtgggcattgttgctggcctggctgtcctagcagttgtggtcatcggagctgtggtcgctactgtgatgtgtaggaggaagagctcaggtggaaaaggagggagctactctcaggctgcgtccagcgacagtgcccagggctctgatgtgtctctcacagcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - major histocompatibility complex, class I, A
- major histocompatibility complex, class I, C
- phosphatase and tensin homolog pseudogene 1
- aldehyde dehydrogenase 3 family, member B2