Login to display prices
Login to display prices
PTENP1-phosphatase and tensin homolog pseudogene 1 Gene View larger

PTENP1-phosphatase and tensin homolog pseudogene 1 Gene

PTXBC038293

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTENP1-phosphatase and tensin homolog pseudogene 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PTENP1-phosphatase and tensin homolog pseudogene 1 Gene

Proteogenix catalog: PTXBC038293
Ncbi symbol: PTENP1
Product name: PTENP1-phosphatase and tensin homolog pseudogene 1 Gene
Size: 2ug
Accessions: BC038293
Gene id: 11191
Gene description: phosphatase and tensin homolog pseudogene 1
Synonyms: 10q23del; BZS; CWS1; DEC; GLM2; MHAM; MMAC1; PTEN1; TEP1; phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTEN; MMAC1 phosphatase and tensin homolog deleted on chromosome 10; mitochondrial PTENalpha; mitochondrial phosphatase and tensin protein alpha; mutated in multiple advanced cancers 1; phosphatase and tensin-like protein; phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTEN; phosphatase and tensin homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggatttcctgcagaaagacttgaaggcgtatacaggaacaatattgatgatgtagtaaggtttttggattcaaagcataaaaaccattacaagatacacaatctttgtgctgaaagacattatgacaccgccaaatctaattacagagttgcgcaatatccttttgaagaccataacccaccacagctagaacttatcaaacccttttgtgaagatcttgaccaatggctaagtgaagatgacaatcatgttgcagcaattcactgtaaagctggaaagggacgaactggtataatgatttatgcatatttattacatcggggcaaatttttaaaggcacaagaggccctagatttctatggggaagtaaggaccagagacaaaaagggagtaactattcccagtcagaggcgctatgtgtattactatagctacctggtaaagaatcatgtggattatagaccagtggcactgttgtttcacaagatgatgtttgaaactattccaatgttcagtggcggaacttgcaatcctcagtttgtggtctgccagctaaaggtgaagatgtattcctccaattcaggacccacacgatgggaggacaagttcatgtattttgagttccctcagccgttacctgtgtgtggtggtatcaaagtagagttcttccacaaacagaacaagatgctaaaaaaggacaaaatgtttcacttttgggtaaatacattcttcataccaggaccagaggaaacctcagaaaaagtagaaaatggaagtctatgtgatcaagaaattgatagcatttgcagtatagagcgtgcagataatgacaaggagtatctagtacttactttaacaaaaaatgatcttgacaaagcaaataaagacaaagccaaccgatacttttctccaaattttaaggtgaagctgtacttcacaaaaacagtagaggagccgtcaaatccagaggctagcagttcaacttctgtaacaccagatgttagtgacaatgaacctgatcattatagatattctgacaccactgactctgatccagagaatgaaccttttgatgaagatcagcatacacaaattacaaaagtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: