Login to display prices
Login to display prices
HLA-A-major histocompatibility complex, class I, A Gene View larger

HLA-A-major histocompatibility complex, class I, A Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-A-major histocompatibility complex, class I, A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-A-major histocompatibility complex, class I, A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008611
Product type: DNA & cDNA
Ncbi symbol: HLA-A
Origin species: Human
Product name: HLA-A-major histocompatibility complex, class I, A Gene
Size: 2ug
Accessions: BC008611
Gene id: 3105
Gene description: major histocompatibility complex, class I, A
Synonyms: MHC class I antigen HLA-A heavy chain; HLAA; HLA class I histocompatibility antigen, A-1 alpha chain; leukocyte antigen class I-A; major histocompatibility complex, class I, A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgtcatggcgccccgaaccctcgtcctgctactctcgggggccctggccctgacccagacctgggcgggctcccactccatgaggtatttctacacctccgtgtcccggcccggccgcggggagccccgcttcatcgccgtgggctacgtggacgacacgcagttcgtgcggttcgacagcgacgccgcgagccagaggatggagccgcgggcgccgtggatagagcaggaggggccggagtattgggaccggaacacacggaatgtgaaggcccactcacagactgaccgagagagcctgcggatcgcgctccgctactacaaccagagcgaggacggttctcacaccatccagaggatgtatggctgcgacgtggggccggacgggcgcttcctccgcgggtaccagcaggacgcttacgacggcaaggattacatcgccctgaacgaggacctgcgctcttggaccgcggcggacatggcggctcagatcacccagcgcaagtgggagacggcccatgaggcggagcagtggagagcctacctggagggccggtgcgtggagtggctccgcagatacctggagaacgggaaggagacgctgcagcgcacggacgcccccaagacgcatatgactcaccacgctgtctctgaccatgaggccaccctgaggtgctgggccctgagcttctaccctgcggagatcacactgacctggcagcgggatggggaggaccagacccaggacacggagctcgtggagaccaggcctgcaggggatgggaccttccagaagtgggcgtctgtggtggtgccttctggacaggagcagagatacacctgccatgtgcagcatgagggtctgcccaagcccctcaccctgagatgggagccgtcttcccagcccaccatccccatcgtgggcatcattgctggcctggttctctttggagctgtgatcgctggagctgtggtcgctgctgtgatgtggaggaggaagagctcagatagaaaaggagggagctactctcaggctgcaagcagtgacagtgcccagggctctgatatgtctctcacagcttgtaaagtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - major histocompatibility complex, class I, C
- phosphatase and tensin homolog pseudogene 1
- aldehyde dehydrogenase 3 family, member B2
- alkB, alkylation repair homolog 1 (E. coli)