Login to display prices
Login to display prices
HLA-G-major histocompatibility complex, class I, G Gene View larger

HLA-G-major histocompatibility complex, class I, G Gene

PTXBC021708

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-G-major histocompatibility complex, class I, G Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-G-major histocompatibility complex, class I, G Gene

Proteogenix catalog: PTXBC021708
Ncbi symbol: HLA-G
Product name: HLA-G-major histocompatibility complex, class I, G Gene
Size: 2ug
Accessions: BC021708
Gene id: 3135
Gene description: major histocompatibility complex, class I, G
Synonyms: HLA-G histocompatibility antigen, class I, G; MHC-G; HLA class I histocompatibility antigen, alpha chain G; HLA G antigen; MHC class I antigen G; b2 microglobulin; major histocompatibility complex, class I, G
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggtcatggcaccccgaaccctcttcctgctactctcgggggccctgaccctgaccgagacctgggcgggctcccactccatgaggtatttcagcgccgccgtgtcccggcccagccgcggggagccccgcttcatcgccatgggctacgtggacgacacgcagttcgtgcggttcgacagcgactcggcgtgtccgaggatggagccgcgggcgccgtgggtggagcgggaggggccagagtattgggaagaggagacacggaacaccaaggcccacgcacagactgacagaatgaacctgcagaccctgcgcggctactacaaccagagcgaggccagttctcataccctccagtggatgattggctgcgacctggggtccgacggacgcctcctccgcgggtatgaacagtatgcctacgatggcaaggattacctcgccctgaacgaggacctgcgctcctggaccgcagcggacactgcggctcagatctccaagcgcaagtgtgaggcggccaatgtggctgaacaaaggagagcctacctggagggcacgtgcgtggagtggctccacagatacctggagaacgggaaggagatgctgcagcgcgcggacccccccaagacacacgtgacccaccaccctgtctttgactatgaggccaccctgaggtgctgggccctgggcttctaccctgcggagatcatactgacctggcagcgggatggggaggaccagacccaggacgtggagctcgtggagaccaagcctgcaggggatggaaccttccagaagtgggcagctgtggtggtgccttctggagaggagcagagatacacgtgccatgtgcagcatgaggggctgccggagcccctcatgctgagatggaagcagtcttccctgcccaccatccccatcatgggtatcgttgctggtctggttgtccttgcagctgtagtcactggagctgcggtcgctgctgtgctgtggaggaagaagagctcagattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: