HLA-G-major histocompatibility complex, class I, G Gene View larger

HLA-G-major histocompatibility complex, class I, G Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-G-major histocompatibility complex, class I, G Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-G-major histocompatibility complex, class I, G Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021708
Product type: DNA & cDNA
Ncbi symbol: HLA-G
Origin species: Human
Product name: HLA-G-major histocompatibility complex, class I, G Gene
Size: 2ug
Accessions: BC021708
Gene id: 3135
Gene description: major histocompatibility complex, class I, G
Synonyms: HLA-G histocompatibility antigen, class I, G; MHC-G; HLA class I histocompatibility antigen, alpha chain G; HLA G antigen; MHC class I antigen G; b2 microglobulin; major histocompatibility complex, class I, G
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggtcatggcaccccgaaccctcttcctgctactctcgggggccctgaccctgaccgagacctgggcgggctcccactccatgaggtatttcagcgccgccgtgtcccggcccagccgcggggagccccgcttcatcgccatgggctacgtggacgacacgcagttcgtgcggttcgacagcgactcggcgtgtccgaggatggagccgcgggcgccgtgggtggagcgggaggggccagagtattgggaagaggagacacggaacaccaaggcccacgcacagactgacagaatgaacctgcagaccctgcgcggctactacaaccagagcgaggccagttctcataccctccagtggatgattggctgcgacctggggtccgacggacgcctcctccgcgggtatgaacagtatgcctacgatggcaaggattacctcgccctgaacgaggacctgcgctcctggaccgcagcggacactgcggctcagatctccaagcgcaagtgtgaggcggccaatgtggctgaacaaaggagagcctacctggagggcacgtgcgtggagtggctccacagatacctggagaacgggaaggagatgctgcagcgcgcggacccccccaagacacacgtgacccaccaccctgtctttgactatgaggccaccctgaggtgctgggccctgggcttctaccctgcggagatcatactgacctggcagcgggatggggaggaccagacccaggacgtggagctcgtggagaccaagcctgcaggggatggaaccttccagaagtgggcagctgtggtggtgccttctggagaggagcagagatacacgtgccatgtgcagcatgaggggctgccggagcccctcatgctgagatggaagcagtcttccctgcccaccatccccatcatgggtatcgttgctggtctggttgtccttgcagctgtagtcactggagctgcggtcgctgctgtgctgtggaggaagaagagctcagattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - replication factor C (activator 1) 5, 36.5kDa
- quaking homolog, KH domain RNA binding (mouse)
- major histocompatibility complex, class I, B
- major histocompatibility complex, class I, A

Buy HLA-G-major histocompatibility complex, class I, G Gene now

Add to cart