Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TSTA3-tissue specific transplantation antigen P35B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TSTA3-tissue specific transplantation antigen P35B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001941 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TSTA3 |
| Origin species: | Human |
| Product name: | TSTA3-tissue specific transplantation antigen P35B Gene |
| Size: | 2ug |
| Accessions: | BC001941 |
| Gene id: | 7264 |
| Gene description: | tissue specific transplantation antigen P35B |
| Synonyms: | P35B; SDR4E1; GDP-L-fucose synthase; 3-5 epimerase/4-reductase; GDP-4-keto-6-deoxy-D-mannose epimerase-reductase; GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase-4-reductase; red cell NADP(H)-binding protein; short chain dehydrogenase/reductase family 4E, member 1; testis tissue sperm-binding protein Li 45a; tissue specific transplantation antigen 3; tissue specific transplantation antigen P35B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtgaaccccagggatccatgcggattctagtgacagggggctctgggctggtaggcaaagccatccagaaggtggtagcagatggagctggacttcctggagaggactgggtgtttgtctcctctaaagacgccgatctcacggatacagcacagacccgcgccctgtttgagaaggtccaacccacacacgtcatccatcttgctgcaatggtggggggcctgttccggaatatcaaatacaatttggacttctggaggaaaaacgtgcacatgaacgacaacgtcctgcactcggcctttgaggtgggcgcccgcaaggtggtgtcctgcctgtccacctgtatcttccctgacaagacgacctacccgatagatgagaccatgatccacaatgggcctccccacaacagcaattttgggtactcgtatgccaagaggatgatcgacgtgcagaacagggcctacttccagcagtacggctgcaccttcaccgctgtcatccccaccaacgtcttcgggccccacgacaacttcaacatcgaggatggccacgtgctgcctggcctcatccacaaggtgcacctggccaagagcagcggctcggccctgacggtgtggggtacagggaatccgcggaggcagttcatatactcgctggacctggcccagctctttatctgggtcctgcgggagtacaatgaagtggagcccatcatcctctccgtgggcgaggaagatgaggtctccatcaaggaggcagccgaggcggtggtggaggccatggacttccatggggaagtcacctttgatacaaccaagtcggatgggcagtttaagaagacagccagtaacagcaagctgaggacctacctgcccgacttccggttcacacccttcaagcaggcggtgaaggagacctgtgcttggttcactgacaactacgagcaggcccggaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - V-set and immunoglobulin domain containing 2 - major histocompatibility complex, class I, G - replication factor C (activator 1) 5, 36.5kDa - quaking homolog, KH domain RNA binding (mouse) |