Login to display prices
Login to display prices
HNRNPA0-heterogeneous nuclear ribonucleoprotein A0 Gene View larger

HNRNPA0-heterogeneous nuclear ribonucleoprotein A0 Gene

PTXBC001008

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HNRNPA0-heterogeneous nuclear ribonucleoprotein A0 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HNRNPA0-heterogeneous nuclear ribonucleoprotein A0 Gene

Proteogenix catalog: PTXBC001008
Ncbi symbol: HNRNPA0
Product name: HNRNPA0-heterogeneous nuclear ribonucleoprotein A0 Gene
Size: 2ug
Accessions: BC001008
Gene id: 10949
Gene description: heterogeneous nuclear ribonucleoprotein A0
Synonyms: HNRPA0; heterogeneous nuclear ribonucleoprotein A0; hnRNA binding protein; hnRNP A0
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaattctcagttgtgtaagctgttcatcggcggcctcaatgtgcagacgagtgagtcgggcctgcgcggccactttgaggcctttgggactctgacggactgcgtggtggtggtgaatccccagaccaagcgctcccgttgctttggcttcgtgacctactccaatgtggaggaggcggacgccgccatggccgcctcgccccatgccgtggacggcaacactgtggagctgaagcgggcggtgtcccgggaggattcggcgcggcccggtgcccacgccaaggttaagaagctctttgtcggaggccttaaaggagacgtggctgagggcgacctgatcgagcacttctcgcagtttggcaccgtggaaaaggccgagattattgccgacaagcagtccggcaagaagcgtggattcggcttcgtgtatttccagaatcacgacgcggcagacaaggccgcggtggtcaagttccatccgattcagggccatcgcgtggaggtgaagaaagcagtccccaaggaggatatctactccggtgggggtggaggcggctcccgatcctcccggggcggccgaggcggccgggggcgcggcggtggtcgagaccagaacggcctttccaagggcggcggcggcggttacaacagctacggtggttacggcggcggcggaggcggcggctacaatgcctacggaggcggcggcggcggttcgtcctacggtgggagcgactacggtaacggcttcggcggcttcggcagctacagccagcatcagtcctcctatgggcccatgaagagcggcggcggcggcggcggtggaggcagtagctggggcggtcgcagtaatagtggaccttacagaggcggctatggcggtgggggtggctatggaggcagctccttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: