HNRNPA0-heterogeneous nuclear ribonucleoprotein A0 Gene View larger

HNRNPA0-heterogeneous nuclear ribonucleoprotein A0 Gene

PTXBC001008

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HNRNPA0-heterogeneous nuclear ribonucleoprotein A0 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HNRNPA0-heterogeneous nuclear ribonucleoprotein A0 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001008
Product type: DNA & cDNA
Ncbi symbol: HNRNPA0
Origin species: Human
Product name: HNRNPA0-heterogeneous nuclear ribonucleoprotein A0 Gene
Size: 2ug
Accessions: BC001008
Gene id: 10949
Gene description: heterogeneous nuclear ribonucleoprotein A0
Synonyms: HNRPA0; heterogeneous nuclear ribonucleoprotein A0; hnRNA binding protein; hnRNP A0
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaattctcagttgtgtaagctgttcatcggcggcctcaatgtgcagacgagtgagtcgggcctgcgcggccactttgaggcctttgggactctgacggactgcgtggtggtggtgaatccccagaccaagcgctcccgttgctttggcttcgtgacctactccaatgtggaggaggcggacgccgccatggccgcctcgccccatgccgtggacggcaacactgtggagctgaagcgggcggtgtcccgggaggattcggcgcggcccggtgcccacgccaaggttaagaagctctttgtcggaggccttaaaggagacgtggctgagggcgacctgatcgagcacttctcgcagtttggcaccgtggaaaaggccgagattattgccgacaagcagtccggcaagaagcgtggattcggcttcgtgtatttccagaatcacgacgcggcagacaaggccgcggtggtcaagttccatccgattcagggccatcgcgtggaggtgaagaaagcagtccccaaggaggatatctactccggtgggggtggaggcggctcccgatcctcccggggcggccgaggcggccgggggcgcggcggtggtcgagaccagaacggcctttccaagggcggcggcggcggttacaacagctacggtggttacggcggcggcggaggcggcggctacaatgcctacggaggcggcggcggcggttcgtcctacggtgggagcgactacggtaacggcttcggcggcttcggcagctacagccagcatcagtcctcctatgggcccatgaagagcggcggcggcggcggcggtggaggcagtagctggggcggtcgcagtaatagtggaccttacagaggcggctatggcggtgggggtggctatggaggcagctccttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hydroxysteroid (17-beta) dehydrogenase 12
- mitogen-activated protein kinase organizer 1
- heterogeneous nuclear ribonucleoprotein A1
- tissue specific transplantation antigen P35B

Buy HNRNPA0-heterogeneous nuclear ribonucleoprotein A0 Gene now

Add to cart