MTCH2-mitochondrial carrier homolog 2 (C. elegans) Gene View larger

MTCH2-mitochondrial carrier homolog 2 (C. elegans) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MTCH2-mitochondrial carrier homolog 2 (C. elegans) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MTCH2-mitochondrial carrier homolog 2 (C. elegans) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000875
Product type: DNA & cDNA
Ncbi symbol: MTCH2
Origin species: Human
Product name: MTCH2-mitochondrial carrier homolog 2 (C. elegans) Gene
Size: 2ug
Accessions: BC000875
Gene id: 23788
Gene description: mitochondrial carrier homolog 2 (C. elegans)
Synonyms: HSPC032; MIMP; SLC25A50; mitochondrial carrier homolog 2; 2310034D24Rik; met-induced mitochondrial protein; solute carrier family 25, member 50; mitochondrial carrier 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggacgcggccagtcaggtgctcctgggctccggtctcaccatcctgtcccagccgctcatgtacgtgaaagtgctcatccaggtgggatatgagcctcttcctccaacaataggacgaaatatttttgggcggcaagtgtgtcagcttcctggtctctttagttatgctcagcacattgccagtatcgatgggaggcgcgggttgttcacaggcttaactccaagactgtgttcgggagtccttggaactgtggtccatggtaaagttttacagcattaccaggagagtgacaagggtgaggagttaggacctggaaatgtacagaaagaagtctcatcttcctttgaccacgttatcaaggagacaactcgagagatgatcgctcgttctgctgctaccctcatcacacatcccttccatgtgatcactctgagatctatggtacagttcattggcagagaatccaagtactgtggactttgtgattccataataaccatctatcgggaagagggcattctaggatttttcgcgggtcttgttcctcgccttctaggtgacatcctttctttgtggctgtgtaactcactggcctacctcgtcaatacctatgcactggacagtggggtttctaccatgaatgaaatgaagagttattctcaagctgtcacaggattttttgcgagtatgttgacctatccctttgtgcttgtctccaatcttatggctgtcaacaactgtggtcttgctggtggatgccctccttactccccaatatatacgtcttggatagactgttggtgcatgctacaaaaagaggggaatatgagccgaggaaatagcttatttttccggaaggtcccctttgggaagacttattgttgtgacctgaaaatgttaatttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - heterogeneous nuclear ribonucleoprotein A0
- hydroxysteroid (17-beta) dehydrogenase 12
- mitogen-activated protein kinase organizer 1
- heterogeneous nuclear ribonucleoprotein A1

Buy MTCH2-mitochondrial carrier homolog 2 (C. elegans) Gene now

Add to cart