Login to display prices
Login to display prices
C4BPB-complement component 4 binding protein, beta Gene View larger

C4BPB-complement component 4 binding protein, beta Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C4BPB-complement component 4 binding protein, beta Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C4BPB-complement component 4 binding protein, beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005378
Product type: DNA & cDNA
Ncbi symbol: C4BPB
Origin species: Human
Product name: C4BPB-complement component 4 binding protein, beta Gene
Size: 2ug
Accessions: BC005378
Gene id: 725
Gene description: complement component 4 binding protein, beta
Synonyms: C4BP; C4b-binding protein beta chain; complement component 4 binding protein beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttttttggtgtgcgtgctgtcttatggttgcgtggcgagtttctgcttcagatgagcactgtccagagcttcctccagtggacaatagcatatttgtcgcaaaggaggtggaaggacagattctggggacttacgtttgtatcaagggctaccacctggtaggaaagaagacccttttttgcaatgcctctaaggagtgggataacaccactactgagtgccgcttgggccactgtcctgatcctgtgctggtgaatggagagttcagttcttcagggcctgtgaatgtaagtgacaaaatcacgtttatgtgcaatgaccactacatcctcaagggcagcaatcggagccagtgtctagaggaccacacctgggcacctccctttcccatctgcaaaagtagggactgtgaccctcctgggaatccagttcatggctattttgaaggaaataacttcaccttaggatccaccattagttattactgtgaagacaggtactacttagtgggcgtgcaggagcagcaatgcgttgatggggagtggagcagtgcacttccagtctgcaagttgatccaggaagctcccaaaccagagtgtgagaaggcacttcttgcctttcaggagagtaagaacctctgcgaagccatggagaactttatgcaacaattaaaggaaagtggcatgacaatggaggagctaaaatattctctggagctgaagaaagctgagttgaaggcaaaattgttgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - palate, lung and nasal epithelium associated
- phosphatidylinositol transfer protein, beta
- hydroxysteroid (17-beta) dehydrogenase 11
- alkB, alkylation repair homolog 4 (E. coli)