FAM98C-family with sequence similarity 98, member C Gene View larger

FAM98C-family with sequence similarity 98, member C Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM98C-family with sequence similarity 98, member C Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM98C-family with sequence similarity 98, member C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034383
Product type: DNA & cDNA
Ncbi symbol: FAM98C
Origin species: Human
Product name: FAM98C-family with sequence similarity 98, member C Gene
Size: 2ug
Accessions: BC034383
Gene id: 147965
Gene description: family with sequence similarity 98, member C
Synonyms: protein FAM98C; family with sequence similarity 98 member C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtccaagaactggaccttaccctccaagccctggggctgcccagacctgcaccagggacccccgccagccagctgctgcaggagttgcatgctaagatctcagagctgcagccttctctgcccccagggtccctgcagcccctcctcagctgctcgctagatgcacccagatgggaagcgttggagtctctgtcccaaagcctcagagatcagtaccgctgccgccgctgcctcctcctcaagcgccttgacctcactacatctgctttccactggagtgaccgggcagaggcccaaggagaggccatgagggcagtgctgatcccaattcgagaggttctgaccccagaatcggacatctccattgcacacgttctggctgcccgagccgacctgtccgcagagggacctgctgtgccatcaacaaggtgcttatgggcaacgttccagaccgggggggccgcccaaatgagctggagcctcccatgcccacctggaggagccgaagagaggatggaggcccccagtgttggggtcgcaagaagaagaagaagaagtaaagggggactggtggtcgggggcggggggtcctccatgagatgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MAD2 mitotic arrest deficient-like 2 (yeast)
- family with sequence similarity 54, member A
- N-acetyltransferase 8 (GCN5-related, putative)
- inverted formin, FH2 and WH2 domain containing

Buy FAM98C-family with sequence similarity 98, member C Gene now

Add to cart