Login to display prices
Login to display prices
MAD2L2-MAD2 mitotic arrest deficient-like 2 (yeast) Gene View larger

MAD2L2-MAD2 mitotic arrest deficient-like 2 (yeast) Gene

PTXBC015244

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAD2L2-MAD2 mitotic arrest deficient-like 2 (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAD2L2-MAD2 mitotic arrest deficient-like 2 (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015244
Product type: DNA & cDNA
Ncbi symbol: MAD2L2
Origin species: Human
Product name: MAD2L2-MAD2 mitotic arrest deficient-like 2 (yeast) Gene
Size: 2ug
Accessions: BC015244
Gene id: 10459
Gene description: MAD2 mitotic arrest deficient-like 2 (yeast)
Synonyms: MAD2B; POLZ2; REV7; mitotic spindle assembly checkpoint protein MAD2B; MAD2 (mitotic arrest deficient, yeast, homolog)-like 2; MAD2-like protein 2; REV7 homolog; hREV7; mitotic arrest deficient 2-like protein 2; mitotic arrest deficient homolog-like 2; polymerase (DNA-directed), zeta 2, accessory subunit; MAD2 mitotic arrest deficient-like 2 (yeast)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccacgctcacacgacaagacctcaactttggccaagtggtggccgatgtgctctgcgagttcctggaggtggctgtgcatctcatcctctacgtgcgcgaggtctaccccgtgggcatcttccagaaacgcaagaagtacaacgtgccggtccagatgtcctgccacccggagctgaatcagtatatccaggacacgctgcactgcgtcaagccactcctggagaagaatgatgtggagaaagtggtggtggtgattttggataaagagcaccgcccagtggagaaattcgtctttgagatcacccagcctccactgctgtccatcagctcagactcgctgttgtctcatgtggagcagctgctccgggccttcatcctgaagatcagcgtgtgcgatgccgtcctggaccacaaccccccaggctgtaccttcacagtcctggtgcacacgagagaagccgccactcgcaacatggagaagatccaggtcatcaaggatttcccctggatcctggcggatgagcaggatgtccacatgcatgacccccggctgataccactaaaaaccatgacgtcggacattttaaagatgcagctttacgtggaagagcgcgctcataaaggcagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 54, member A
- N-acetyltransferase 8 (GCN5-related, putative)
- inverted formin, FH2 and WH2 domain containing
- Kv channel interacting protein 3, calsenilin