RAB35-RAB35, member RAS oncogene family Gene View larger

RAB35-RAB35, member RAS oncogene family Gene

PTXBC015931

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB35-RAB35, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB35-RAB35, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015931
Product type: DNA & cDNA
Ncbi symbol: RAB35
Origin species: Human
Product name: RAB35-RAB35, member RAS oncogene family Gene
Size: 2ug
Accessions: BC015931
Gene id: 11021
Gene description: RAB35, member RAS oncogene family
Synonyms: RAB35, member RAS oncogene family; H-ray; RAB1C; RAY; ras-related protein Rab-35; GTP-binding protein RAY; ras-related protein rab-1c (GTP-binding protein ray)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccgggactacgaccacctcttcaagctgctcatcatcggcgacagcggtgtgggcaagagcagtttactgttgcgttttgcagacaacactttctcaggcagctacatcaccacgatcggagtggatttcaagatccggaccgtggagatcaacggggagaaggtgaagctgcagatctgggacacagcggggcaggagcgcttccgcaccatcacctccacgtattatcgggggacccacggggtcattgtggtttacgacgtcaccagtgccgagtcctttgtcaacgtcaagcggtggcttcacgaaatcaaccagaactgtgatgatgtgtgccgaatattagtgggtaataagaatgacgaccctgagcggaaggtggtggagacggaagatgcctacaaattcgccgggcagatgggcatccagttgttcgagaccagcgccaaggagaatgtcaacgtggaagagatgttcaactgcatcacggagctggtcctccgagcaaagaaagacaacctggcaaaacagcagcagcaacaacagaacgatgtggtgaagctcacgaagaacagtaaacgaaagaaacgctgctgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB13, member RAS oncogene family
- RAB18, member RAS oncogene family
- TIMP metallopeptidase inhibitor 1
- RAB38, member RAS oncogene family

Buy RAB35-RAB35, member RAS oncogene family Gene now

Add to cart