Login to display prices
Login to display prices
RAB10-RAB10, member RAS oncogene family Gene View larger

RAB10-RAB10, member RAS oncogene family Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB10-RAB10, member RAS oncogene family Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RAB10-RAB10, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000896
Product type: DNA & cDNA
Ncbi symbol: RAB10
Origin species: Human
Product name: RAB10-RAB10, member RAS oncogene family Gene
Size: 2ug
Accessions: BC000896
Gene id: 10890
Gene description: RAB10, member RAS oncogene family
Synonyms: RAB10, member RAS oncogene family; GTP-binding protein RAB10; ras-related protein Rab-10; ras-related GTP-binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaagaagacgtacgacctgcttttcaagctgctcctgatcggggattccggagtggggaagacctgcgtcctttttcgtttttcggatgatgccttcaatactacctttatttccaccataggaatagacttcaagatcaaaacagttgaattacaaggaaagaagatcaagctacagatatgggatacagcaggccaggagcgatttcacaccatcacaacctcctactacagaggcgcaatgggtatcatgctagtatatgacatcaccaatggtaaaagttttgaaaacatcagcaaatggcttagaaacatagatgagcatgccaatgaagatgtggaaagaatgttactaggaaacaagtgtgatatggacgacaaaagagttgtacctaaaggaaaaggagaacagattgcaagggagcatggtattaggttttttgagactagtgcaaaagcaaatataaacatcgaaaaggcgttcctcacgttagctgaagatatccttcgaaagacccctgtaaaagagcccaacagtgaaaatgtagatatcagcagtggaggaggcgtgacaggctggaagagcaaatgctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB35, member RAS oncogene family
- RAB13, member RAS oncogene family
- RAB18, member RAS oncogene family
- TIMP metallopeptidase inhibitor 1