Login to display prices
Login to display prices
H1F0-H1 histone family, member 0 Gene View larger

H1F0-H1 histone family, member 0 Gene

PTXBC000145

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of H1F0-H1 histone family, member 0 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about H1F0-H1 histone family, member 0 Gene

Proteogenix catalog: PTXBC000145
Ncbi symbol: H1F0
Product name: H1F0-H1 histone family, member 0 Gene
Size: 2ug
Accessions: BC000145
Gene id: 3005
Gene description: H1 histone family, member 0
Synonyms: H10; H1FV; histone H1.0; H1.0, H1(0), H1-0; histone H1'; histone H1(0); H1 histone family member 0
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccgagaattccacgtccgcccctgcggccaagcccaagcgggccaaggcctccaagaagtccacagaccaccccaagtattcagacatgatcgtggctgccatccaggccgagaagaaccgcgctggctcctcgcgccagtccattcagaagtatatcaagagccactacaaggtgggtgagaacgctgactcgcagatcaagttgtccatcaagcgcctggtcaccaccggtgtcctcaagcagaccaaaggggtgggggcctcggggtccttccggctagccaagagcgacgaacccaagaagtcagtggccttcaagaagaccaagaaggaaatcaagaaggtagccacgccaaagaaggcatccaagcccaagaaggctgcctccaaagccccaaccaagaaacccaaagccaccccggtcaagaaggccaagaagaagctggctgccacgcccaagaaagccaaaaaacccaagactgtcaaagccaagccggtcaaggcatccaagcccaaaaaggccaaaccagtgaaacccaaagcaaagtccagtgccaagagggccggcaagaagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice