H1F0-H1 histone family, member 0 Gene View larger

H1F0-H1 histone family, member 0 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of H1F0-H1 histone family, member 0 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about H1F0-H1 histone family, member 0 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000145
Product type: DNA & cDNA
Ncbi symbol: H1F0
Origin species: Human
Product name: H1F0-H1 histone family, member 0 Gene
Size: 2ug
Accessions: BC000145
Gene id: 3005
Gene description: H1 histone family, member 0
Synonyms: H10; H1FV; histone H1.0; H1.0, H1(0), H1-0; histone H1'; histone H1(0); H1 histone family member 0
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccgagaattccacgtccgcccctgcggccaagcccaagcgggccaaggcctccaagaagtccacagaccaccccaagtattcagacatgatcgtggctgccatccaggccgagaagaaccgcgctggctcctcgcgccagtccattcagaagtatatcaagagccactacaaggtgggtgagaacgctgactcgcagatcaagttgtccatcaagcgcctggtcaccaccggtgtcctcaagcagaccaaaggggtgggggcctcggggtccttccggctagccaagagcgacgaacccaagaagtcagtggccttcaagaagaccaagaaggaaatcaagaaggtagccacgccaaagaaggcatccaagcccaagaaggctgcctccaaagccccaaccaagaaacccaaagccaccccggtcaagaaggccaagaagaagctggctgccacgcccaagaaagccaaaaaacccaagactgtcaaagccaagccggtcaaggcatccaagcccaaaaaggccaaaccagtgaaacccaaagcaaagtccagtgccaagagggccggcaagaagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CD164 molecule, sialomucin
- B-cell translocation gene 4
- clathrin, light chain (Lcb)
- myelin expression factor 2

Buy H1F0-H1 histone family, member 0 Gene now

Add to cart