Login to display prices
Login to display prices
MYEF2-myelin expression factor 2 Gene View larger

MYEF2-myelin expression factor 2 Gene

PTXBC014533

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MYEF2-myelin expression factor 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MYEF2-myelin expression factor 2 Gene

Proteogenix catalog: PTXBC014533
Ncbi symbol: MYEF2
Product name: MYEF2-myelin expression factor 2 Gene
Size: 2ug
Accessions: BC014533
Gene id: 50804
Gene description: myelin expression factor 2
Synonyms: HsT18564; MEF-2; MST156; MSTP156; myEF-2; myelin expression factor 2; myelin gene expression factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatggtccaggttttggaggaatgaatagaattggaggaggaatagggtttggtggtctggaagcaatgaatagcatgggaggatttggaggagttggccgaatgggagagctgtaccgtggtgcgatgactagtagcatggagcgagattttggacgtggtgatattggaataaatcgaggctttggagattcctttggtagacttggtggtggaatgggtagcatgaacagtgtgactggaggaatggggatgggactggaccggatgagttccagctttgatagaatgggaccaggtataggagctatactggaaaggagcatcgatatggatcgaggatttttatcgggtccaatgggaagcggaatgagagagagaataggctccaaaggcaaccagatatttgtcagaaatctaccttttgacttgacttggcagaaactaaaagagaaattcagtcagtgtggtcatgtaatgtttgcagaaataaaaatggagaatggaaagtcaaaaggctgtggaacagtcagatttgactccccagaatcagctgaaaaagcctgcagaataatgaatggcataaaaatcagtggcagagaaattgatgttcgcttggatcgtaatgcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: