Login to display prices
Login to display prices
WBP2-WW domain binding protein 2 Gene View larger

WBP2-WW domain binding protein 2 Gene

PTXBC007452

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WBP2-WW domain binding protein 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WBP2-WW domain binding protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007452
Product type: DNA & cDNA
Ncbi symbol: WBP2
Origin species: Human
Product name: WBP2-WW domain binding protein 2 Gene
Size: 2ug
Accessions: BC007452
Gene id: 23558
Gene description: WW domain binding protein 2
Synonyms: GRAMD6; WBP-2; WW domain-binding protein 2; WW domain binding protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctcaacaagaatcactcggagggcggcggagtgatcgtcaataacaccgagagcatcctaatgtcctatgatcacgtggaactcacattcaatgacatgaagaacgtgccagaagccttcaaagggaccaagaaaggcactgtctaccttaccccttaccgggtcatctttctgtccaagggcaaggatgccatgcagtccttcatgatgccattttatctcatgaaagactgtgagatcaagcagcccgtatttggtgcaaactacatcaagggaacagtgaaggcggaagcgggaggtggctgggaaggctctgcttcctacaagttgactttcacggcagggggcgccattgagttcggacagcggatgctccaggtggcatctcaagcctccagaggtgaagtccccagtggagcctatggctactcttacatgcccagcggggcctatgtctatcccccgccagtcgccaatggaatgtacccctgccctcctggctacccctatccaccgcccccacctgagttctatccaggaccccccatgatggacggggccatgggatacgtgcagcccccaccaccgccctaccctgggcccatggaacctccggtcagcggccccgatgtcccctccactcctgcagccgaagccaaggccgcagaagcagccgccagcgcctattacaacccaggcaatcctcacaacgtctacatgcccacgagccagccgccgccacctccctactacccaccggaagataagaagacccagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - T cell receptor alpha locus
- myelin protein zero-like 1
- rogdi homolog (Drosophila)
- zinc finger, matrin type 3