Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 369,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 369,00 €
Data sheet of ZMAT3-zinc finger, matrin type 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZMAT3-zinc finger, matrin type 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002896 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZMAT3 |
| Origin species: | Human |
| Product name: | ZMAT3-zinc finger, matrin type 3 Gene |
| Size: | 2ug |
| Accessions: | BC002896 |
| Gene id: | 64393 |
| Gene description: | zinc finger, matrin type 3 |
| Synonyms: | PAG608; WIG-1; WIG1; zinc finger matrin-type protein 3; WIG-1/PAG608 protein; p53 target zinc finger protein; p53-activated gene 608 protein; zinc finger protein WIG1; zinc finger matrin-type 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcctcttgcaacacgccgtgcttcctccacctaagcagccctcaccctcgcctcctatgtcagtggccaccaggtctacaggaaccttgcagcttccaccacagaagccttttgggcaggaggcttccttgcctcttgcaggggaagaagagttatcgaagggaggggagcaagactgtgccctggaggagctatgtaagcccctgtactgcaaactctgcaatgtcaccttgaactctgcacagcaagcccaggctcattatcagggtaaaaatcatggtaagaaactccgaaattactatgcagcaaatagctgtcctcctcctgctagaatgagcaatgtggtcgagcctgcagctactccagttgttccagtccctccgcagatgggctcctttaagccaggaggccgagtgatcctggccacggagaatgattactgtaagctctgtgatgcctccttcagttccccagctgtggctcaggctcactatcaagggaagaatcatgccaagaggctgcggctggcggaagctcagagtaactcattctcggaatcctcagagctgggtcaacggcgggccaggaaagaagggaatgagtttaagatgatgcctaacaggagaaatatgtatacagtacagaataattcagcaggtccttacttcaatccccgctctcggcagagaattccacgtgatctggccatgtgtgttactccaagtggccagttttactgctcaatgtgtaatgttggagctggcgaagagatggaattccggcagcatttagagagcaagcaacataagagcaaggtgtctgaacagcggtacaggaatgagatggagaatctgggatatgtatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ventral anterior homeobox 2 - phospholipid scramblase 3 - ECSIT homolog (Drosophila) - ankyrin repeat domain 29 |