Login to display prices
Login to display prices
ZMAT3-zinc finger, matrin type 3 Gene View larger

ZMAT3-zinc finger, matrin type 3 Gene

PTXBC002896

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZMAT3-zinc finger, matrin type 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZMAT3-zinc finger, matrin type 3 Gene

Proteogenix catalog: PTXBC002896
Ncbi symbol: ZMAT3
Product name: ZMAT3-zinc finger, matrin type 3 Gene
Size: 2ug
Accessions: BC002896
Gene id: 64393
Gene description: zinc finger, matrin type 3
Synonyms: PAG608; WIG-1; WIG1; zinc finger matrin-type protein 3; WIG-1/PAG608 protein; p53 target zinc finger protein; p53-activated gene 608 protein; zinc finger protein WIG1; zinc finger matrin-type 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatcctcttgcaacacgccgtgcttcctccacctaagcagccctcaccctcgcctcctatgtcagtggccaccaggtctacaggaaccttgcagcttccaccacagaagccttttgggcaggaggcttccttgcctcttgcaggggaagaagagttatcgaagggaggggagcaagactgtgccctggaggagctatgtaagcccctgtactgcaaactctgcaatgtcaccttgaactctgcacagcaagcccaggctcattatcagggtaaaaatcatggtaagaaactccgaaattactatgcagcaaatagctgtcctcctcctgctagaatgagcaatgtggtcgagcctgcagctactccagttgttccagtccctccgcagatgggctcctttaagccaggaggccgagtgatcctggccacggagaatgattactgtaagctctgtgatgcctccttcagttccccagctgtggctcaggctcactatcaagggaagaatcatgccaagaggctgcggctggcggaagctcagagtaactcattctcggaatcctcagagctgggtcaacggcgggccaggaaagaagggaatgagtttaagatgatgcctaacaggagaaatatgtatacagtacagaataattcagcaggtccttacttcaatccccgctctcggcagagaattccacgtgatctggccatgtgtgttactccaagtggccagttttactgctcaatgtgtaatgttggagctggcgaagagatggaattccggcagcatttagagagcaagcaacataagagcaaggtgtctgaacagcggtacaggaatgagatggagaatctgggatatgtatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: