VAX2-ventral anterior homeobox 2 Gene View larger

VAX2-ventral anterior homeobox 2 Gene

PTXBC006336

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VAX2-ventral anterior homeobox 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VAX2-ventral anterior homeobox 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006336
Product type: DNA & cDNA
Ncbi symbol: VAX2
Origin species: Human
Product name: VAX2-ventral anterior homeobox 2 Gene
Size: 2ug
Accessions: BC006336
Gene id: 25806
Gene description: ventral anterior homeobox 2
Synonyms: DRES93; ventral anterior homeobox 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcgatgggggcgccgagcgcgaccggggccccgcgcgccgggcggagtctggtggcggcggtgggcgctgcggagaccgcagcggagcgggggacttgcgagctgatggcggtggccacagcccaacggaggtggccgggacctcagcctccagtcccgcaggctccagggagagtggagccgacagcgacgggcagcccgggcccggcgaggcagaccactgccgccgcatactggtgcgagatgccaaagggacaattcgggaaattgtcctgcctaagggcctggacctggaccggcccaagcggacacgtacatccttcactgccgagcagctgtaccgcctggagatggagttccagcgctgccagtatgtggtgggccgcgagcgcactgagctggcccgccagctgaacctctccgagacccaggtgaaggtctggttccagaaccgccgcaccaagcagaagaaagaccagagcagagacctggagaagcgggcgtcctcctcagcctccgaggcctttgccacctccaacattctgcggctgctggagcagggccggctgctctctgtgcccagggcccctagcctcctggcgctgacccctagcctgccaggcctacctgccagccacaggggcacctccttaggtgaccccaggaactcctccccacgcctcaacccgctgtcctcggcctcagcgtcccccccactgccgccccctctgccagctgtctgcttttcctcggccccgctcctggatctgcctgccggctacgaactgggttcctcggccttcgagccatacagctggctagaacggaaagtgggcagcgccagcagctgcaagaaagctaacacttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phospholipid scramblase 3
- ECSIT homolog (Drosophila)
- ankyrin repeat domain 29
- EBNA1 binding protein 2

Buy VAX2-ventral anterior homeobox 2 Gene now

Add to cart