EBNA1BP2-EBNA1 binding protein 2 Gene View larger

EBNA1BP2-EBNA1 binding protein 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EBNA1BP2-EBNA1 binding protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EBNA1BP2-EBNA1 binding protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009175
Product type: DNA & cDNA
Ncbi symbol: EBNA1BP2
Origin species: Human
Product name: EBNA1BP2-EBNA1 binding protein 2 Gene
Size: 2ug
Accessions: BC009175
Gene id: 10969
Gene description: EBNA1 binding protein 2
Synonyms: EBP2; NOBP; P40; nuclear FGF3 binding protein; nucleolar protein p40; nucleolar protein p40; homolog of yeast EBNA1-binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacactcccccgctctcggattcggagtcggaatccgatgaatcccttgtcacagacagagagttgcaggatgcgttttcccgagggcttctgaagccaggcctcaatgtcgtgctagaggggccgaagaaggccgtgaacgacgtgaatggcctgaagcaatgtttggcagaattcaagcgggatctggaatgggttgaaaggctcgatgtgacactgggtccggtaccggagatcggtggatctgaggcgccagcacctcagaacaaggaccagaaagctgttgatccagaagacgacttccagcgagagatgagtttctatcgccaagcccaggccgcagtgcttgcagtcttaccccgcctccatcagctcaaagtccctacgaagcgacccactgattattttgcggaaatggccaaatctgatctgcagatgcagaagattcgacagaagctgcagactaaacaggctgccatggagaggtctgaaaaagctaagcaactgcgagcacttaggaaatacgggaagaaggtgcaaacggaggttcttcagaagaggcagcaggagaaagcccatatgatgaatgctattaagaaatatcagaaaggcttctctgataaactggatttccttgagggagatcagaaacctctggcacagcgcaagaaggcaggagccaaaggccagcagatgaggaaggggcccagtgctaaacgacggtataaaaaccagaagtttggttttggtggaaagaagaaaggctcaaagtggaacactcgggagagctatgatgatgtatctagcttccgggccaagacagctcatggcagaggcctcaagaggcctggcaagaaagggtcaaataagagacctggaaaacgaacaagagagaagatgaagaacagaacacactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phospholipid scramblase 1
- Hermansky-Pudlak syndrome 1
- apoptosis enhancing nuclease
- apoptosis enhancing nuclease

Buy EBNA1BP2-EBNA1 binding protein 2 Gene now

Add to cart