Login to display prices
Login to display prices
AEN-apoptosis enhancing nuclease Gene View larger

AEN-apoptosis enhancing nuclease Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AEN-apoptosis enhancing nuclease Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AEN-apoptosis enhancing nuclease Gene

Proteogenix catalog: PTXBC020988
Ncbi symbol: AEN
Product name: AEN-apoptosis enhancing nuclease Gene
Size: 2ug
Accessions: BC020988
Gene id: 64782
Gene description: apoptosis enhancing nuclease
Synonyms: ISG20L1; pp12744; apoptosis-enhancing nuclease; interferon stimulated exonuclease gene 20kDa-like 1; interferon-stimulated 20 kDa exonuclease-like 1; apoptosis enhancing nuclease
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtaccccgggaggcccctgagtctgctcagtgcctgtgcccttccctcaccatcccaaatgccaaggatgtgcttcggaagaggcacaagagaaggagccgacagcaccagcggttcatggcccggaaggccttgctgcaggagcaggggctgctgagcatgcctccagaaccagggtcctccccactgcccacccctttcggggcagcgacagcaactgaagctgccagcagtgggaagcagtgtctgagggctggatctggcagtgccccatgcagcagaaggcctgctcccgggaaagcctcagggcccttgcccagcaagtgtgtggctatcgactgtgagatggtgggcacgggaccccgagggcgggtaagcgagctggcccgctgttccattgtgagctaccatggcgatgtcctctatgacaagtacatcaggcctgagatgcccatcgctgactaccgtacccgctggagtggcatcactcggcagcacatgcgcaaggctgtccccttccaggtggcccagaaagagatccttaagctcctgaagggcaaggtggtggtggggcacgcgctgcacaacgacttccaggcgctcaagtatgtccaccctcggagccagacccgggataccacctatgtcccaaacttcctcagcgagcccggcctccacacccgggcccgggtctctctaaaggacctggccctgcagctgctgcacaagaagatccaggtgggccagcacgggcactcatcagtagaagatgccacgacagccatggagctctaccggctggtggaggtgcagtgggaacagcaggaggcccgcagcctctggacctgccccgaggacagagaacctgacagcagcacagacatggaacagtacatggaggaccagtactggcccgatgacctggcccacggcagcagaggaggagccagggaggcacaggacagaaggaattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: