Login to display prices
Login to display prices
PLSCR4-phospholipid scramblase 4 Gene View larger

PLSCR4-phospholipid scramblase 4 Gene

PTXBC028354

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLSCR4-phospholipid scramblase 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PLSCR4-phospholipid scramblase 4 Gene

Proteogenix catalog: PTXBC028354
Ncbi symbol: PLSCR4
Product name: PLSCR4-phospholipid scramblase 4 Gene
Size: 2ug
Accessions: BC028354
Gene id: 57088
Gene description: phospholipid scramblase 4
Synonyms: TRA1; phospholipid scramblase 4; Ca(2+)-dependent phospholipid scramblase 4; PL scramblase 4; cell growth inhibiting protein 43
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcaggtgtggtacccacagcccctgaacagcctgcaggtgaaatggaaaatcaaacaaaaccaccagatccaaggcctgatgctcctcctgaatacaattctcattttttaccaggaccccctggaacagctgtccctccacctactggctacccaggaggcttgcctatgggatactacagtccacagcaacccagtaccttccctttgtaccagccagttggtggtatccatcctgtccggtatcagcctggcaaatatcctatgccaaatcagtctgttccaataacatggatgccagggccaactcctatggcaaactgccctcctggtctggaatacttagttcagttggacaacatacatgttcttcagcattttgagcctctggaaatgatgacatgttttgaaactaataatagatatgatattaaaaacaactcagaccagatggtttacattgtaaccgaagacacagatgactttaccaggaatgcctatcggacactaaggcccttcgtcctccgggtcactgattgtatgggccgagaaatcatgacaatgcagagacccttcagatgcacctgctgttgcttctgttgcccctctgccagacaagagctggaggtgcagtgtcctcctggtgtcaccattggctttgttgcggaacattggaacctgtgcagggcggtgtacagcatccaaaatgagaagaaagaaaatgtgatgagagttcgtgggccatgctcaacctatggctgtggttcagattctgtttttgaggtcaaatcccttgatggcatatccaacatcggcagtattatccggaagtggaatggtttgttatcagcaatggcagatgctgaccattttgacattcacttcccactagacctggatgtgaagatgaaagccatgatttttggagcttgcttcctcattgacttcatgtattttgaaagatctccaccacaacgttcaagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: