PLSCR4-phospholipid scramblase 4 Gene View larger

PLSCR4-phospholipid scramblase 4 Gene

PTXBC028354

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLSCR4-phospholipid scramblase 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PLSCR4-phospholipid scramblase 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028354
Product type: DNA & cDNA
Ncbi symbol: PLSCR4
Origin species: Human
Product name: PLSCR4-phospholipid scramblase 4 Gene
Size: 2ug
Accessions: BC028354
Gene id: 57088
Gene description: phospholipid scramblase 4
Synonyms: TRA1; phospholipid scramblase 4; Ca(2+)-dependent phospholipid scramblase 4; PL scramblase 4; cell growth inhibiting protein 43
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcaggtgtggtacccacagcccctgaacagcctgcaggtgaaatggaaaatcaaacaaaaccaccagatccaaggcctgatgctcctcctgaatacaattctcattttttaccaggaccccctggaacagctgtccctccacctactggctacccaggaggcttgcctatgggatactacagtccacagcaacccagtaccttccctttgtaccagccagttggtggtatccatcctgtccggtatcagcctggcaaatatcctatgccaaatcagtctgttccaataacatggatgccagggccaactcctatggcaaactgccctcctggtctggaatacttagttcagttggacaacatacatgttcttcagcattttgagcctctggaaatgatgacatgttttgaaactaataatagatatgatattaaaaacaactcagaccagatggtttacattgtaaccgaagacacagatgactttaccaggaatgcctatcggacactaaggcccttcgtcctccgggtcactgattgtatgggccgagaaatcatgacaatgcagagacccttcagatgcacctgctgttgcttctgttgcccctctgccagacaagagctggaggtgcagtgtcctcctggtgtcaccattggctttgttgcggaacattggaacctgtgcagggcggtgtacagcatccaaaatgagaagaaagaaaatgtgatgagagttcgtgggccatgctcaacctatggctgtggttcagattctgtttttgaggtcaaatcccttgatggcatatccaacatcggcagtattatccggaagtggaatggtttgttatcagcaatggcagatgctgaccattttgacattcacttcccactagacctggatgtgaagatgaaagccatgatttttggagcttgcttcctcattgacttcatgtattttgaaagatctccaccacaacgttcaagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ring finger protein 113A
- TDP-glucose 4,6-dehydratase
- TEA domain family member 4
- RNA binding motif protein 4

Buy PLSCR4-phospholipid scramblase 4 Gene now

Add to cart