TEAD4-TEA domain family member 4 Gene View larger

TEAD4-TEA domain family member 4 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TEAD4-TEA domain family member 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TEAD4-TEA domain family member 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015497
Product type: DNA & cDNA
Ncbi symbol: TEAD4
Origin species: Human
Product name: TEAD4-TEA domain family member 4 Gene
Size: 2ug
Accessions: BC015497
Gene id: 7004
Gene description: TEA domain family member 4
Synonyms: EFTR-2; RTEF1; TCF13L1; TEF-3; TEF3; TEFR-1; hRTEF-1B; transcriptional enhancer factor TEF-3; TEA domain family member 4; related transcription enhancer factor 1B; transcription factor 13-like 1; transcription factor RTEF-1; transcriptional enhancer factor 1-related; transcriptional enhancer factor 3; TEA domain transcription factor 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtatggtcggaacgagctgattgcccgctacatcaagctccggacagggaagacccgcaccaggaagcaggtctccagccacatccaggtgctggctcgtcgcaaagctcgcgagatccaggccaagctaaaggaccaggcagctaaggacaaggccctgcagagcatggctgccatgtcgtctgcacagatcatctccgccacggccttccacagtagcatggccctcgcccggggccccggccgcccagcagtctcagggttttggcaaggagctttgccaggccaagccggaacgtcccatgatgtgaagcctttctctcagcaaacctatgctgtccagcctccgctgcctctgccagggtttgagtctcctgcagggcccgccccatcgccctctgcgcccccggcacccccatggcagggccgcagcgtggccagctccaagctctggatgttggagttctctgccttcctggagcagcagcaggacccggacacgtacaacaagcacctgttcgtgcacattggccagtccagcccaagctacagcgacccctacctcgaagccgtggacatccgccaaatctatgacaaattcccggagaaaaagggtggactcaaggatctcttcgaacggggaccctccaatgccttttttcttgtgaagttctgggcagacctcaacaccaacatcgaggatgaaggcagctccttctatggggtctccagccagtatgagagccccgagaacatgatcatcacctgctccacgaaggtctgctctttcggcaagcaggtggtggagaaagttgagacagagtatgctcgctatgagaatggacactactcttaccgcatccaccggtccccgctctgtgagtacatgatcaacttcatccacaagctcaagcacctccctgagaagtacatgatgaacagcgtgctggagaacttcaccatcctgcaggtggtcaccaacagagacacacaggagaccttgctgtgcattgcctatgtctttgaggtgtcagccagtgagcacggggctcagcaccacatctacaggctggtgaaagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA binding motif protein 4
- neuropeptide Y receptor Y1
- pelota homolog (Drosophila)
- matrix metallopeptidase 28

Buy TEAD4-TEA domain family member 4 Gene now

Add to cart