AEN-apoptosis enhancing nuclease Gene View larger

AEN-apoptosis enhancing nuclease Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AEN-apoptosis enhancing nuclease Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AEN-apoptosis enhancing nuclease Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005164
Product type: DNA & cDNA
Ncbi symbol: AEN
Origin species: Human
Product name: AEN-apoptosis enhancing nuclease Gene
Size: 2ug
Accessions: BC005164
Gene id: 64782
Gene description: apoptosis enhancing nuclease
Synonyms: ISG20L1; pp12744; apoptosis-enhancing nuclease; interferon stimulated exonuclease gene 20kDa-like 1; interferon-stimulated 20 kDa exonuclease-like 1; apoptosis enhancing nuclease
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtaccccgggaggcccctgagtctgctcagtgcctgtgcccttccctcaccatcccaaatgccaaggatgtgcttcggaagaggcacaagagaaggagccgacagcaccagcggttcatggcccggaaggccttgctgcaggagcaggggctgctgagcatgcctccagagccagggtcctccccactgcccacccctttcggggcagcgacagcaactgaagctgccagcagtgggaagcagtgtctgagggctggatctggcagtgccccatgcagcagaaggcctgctcccgggaaagcctcagggcccttgcccagcaagtgtgtggctatcgactgtgagatggtgggcacgggaccccgagggcgggtaagcgagctggcccgctgttccattgtgagctaccatggcgatgtcctctatgacaagtacatcaggcctgagatgcccatcgctgactaccgtacccgctggagtggcatcactcggcagcacatgcgcaaggctgtccccttccaggtggcccagaaagagatccttaagctcctgaagggcaaggtggtggtggggcacgcgctgcacaacgacttccaggcgctcaagtatgtccaccctcggagccagacccgggataccacctatgtcccaaacttcctcagcgagcccggcctccacacccgggcccgggtctctctaaaggacctggccctgcagctgctgcacaagaagatccaggtgggccagcacgggcactcatcagtagaagatgccacgacagccatggagctctaccggctggtggaggtgcagtgggaacagcaggaggcccgcagcctctggacctgccccgaggacagagaacctgacagcagcacagacatggaacagtacatggaggaccagtccacccagtactgggctcttaagcaaaagtctgagaaacaagacagtggtttgaattctggggcctttgtgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PIN2-interacting protein 1
- phospholipid scramblase 4
- ring finger protein 113A
- TDP-glucose 4,6-dehydratase

Buy AEN-apoptosis enhancing nuclease Gene now

Add to cart