PINX1-PIN2-interacting protein 1 Gene View larger

PINX1-PIN2-interacting protein 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PINX1-PIN2-interacting protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PINX1-PIN2-interacting protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015479
Product type: DNA & cDNA
Ncbi symbol: PINX1
Origin species: Human
Product name: PINX1-PIN2-interacting protein 1 Gene
Size: 2ug
Accessions: BC015479
Gene id: 54984
Gene description: PIN2-interacting protein 1
Synonyms: LPTL; LPTS; PIN2/TERF1-interacting telomerase inhibitor 1; 67-11-3 protein; PIN2-interacting protein 1; TRF1-interacting protein 1; hepatocellular carcinoma-related putative tumor suppressor; liver-related putative tumor suppressor; pin2-interacting protein X1; protein 67-11-3; PIN2/TERF1 interacting, telomerase inhibitor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctatgctggctgaacgtcggcggaagcagaagtgggctgtggatcctcagaacactgcctggagtaatgacgattccaagtttggccagcggatgctagagaagatggggtggtctaaaggaaagggtttaggggctcaggagcacggagccacagatcatattaaagttcaagtgaaaaataaccacctgggactcggagctaccatcaataatgaagacaactggattgcccatcaggatgattttaaccagcttctggccgaactgaacacttgccatgggcaggaaaccacagattcctcggacaagaaggaaaagaaatcttttagccttgaggaaaagtccaaaatctccaaaaaccgtgttcactatatgaaattcacaaaagggaaggatctgtcatctcggagcaaaacagatcttgactgcatttttgggaaaagacagagtaagaagactcccgagggcgatgccagtccctccactccagaggagaacgaaaccacgacaaccagcgccttcaccatccaggagtactttgccaagcggatggcagcactgaagaacaagccccaggttccagttccagggtctgacatttctgagacgcaggtggaacgtaaaagggggaagaaaataaataaagaggccacaggtaaagatgtggaaagttacctccagcctaaggccaagaggcacacggagggaaagcccgagagggccgaggcccaggagcgagtggccaagaagaagagcgcgccagcagaagagcagctcagaggcccctgctgggaccagagttccaaggcctctgctcaggatgcaggggaccatgtgcagccgcctgagggccgggacttcaccctgaagcccaaaaagaggagagggaagaaaaagctgcaaaaaccagtagagatagcagaggacgctacactagaagaaacgctagtgaaaaagaagaagaagaaagattccaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phospholipid scramblase 4
- ring finger protein 113A
- TDP-glucose 4,6-dehydratase
- TEA domain family member 4

Buy PINX1-PIN2-interacting protein 1 Gene now

Add to cart