Login to display prices
Login to display prices
ANKRD29-ankyrin repeat domain 29 Gene View larger

ANKRD29-ankyrin repeat domain 29 Gene

PTXBC030622

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ANKRD29-ankyrin repeat domain 29 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ANKRD29-ankyrin repeat domain 29 Gene

Proteogenix catalog: PTXBC030622
Ncbi symbol: ANKRD29
Product name: ANKRD29-ankyrin repeat domain 29 Gene
Size: 2ug
Accessions: BC030622
Gene id: 147463
Gene description: ankyrin repeat domain 29
Synonyms: ankyrin repeat domain-containing protein 29; ankyrin repeat domain 29
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgcaggatgtccttcaagaaggaaactccacttgccaatgctgcattctgggcagccaggagaggaaacctggcgctgctgaagctgctgttgaacagcggccgggtggacgtggactgcagagacagccatggcaccacactcctgatggttgctgcctacgctggccacatagactgtgtgagggaactggttctgcaaggagcagacatcaatctccagagagagtcaggtacaactgccctattctttgccgcccagcaaggccataatgatgtcgtgagatttctctttggatttggagcatccactgaatttaggaccaaagacgagggcaccgccctgttggctgccagtcagtacgggcacatgcaggtggtggagaccttgctgaagcacggagcaaacatccatgaccaactttatgatggagccactgccctcttcctagctgcccaaggtggttacttggatgttattcgattactgctggcttcaggagcaaaagtcaaccagccaaggcaggacgggacagcgcccctgtggatcgcgtcccagatgggccacagcgaggtggtgcgggtgatgctgctgcgcggagccgaccgcgacgctgcgcggaacgatggcacaacagcattattgaaagcagccaacaaagggtataatgatgtcataaaagagttgcttaaattctcacccactcttggtattttgaagaatgggacatcagcgctccatgcagcagtgctcagtggaaacattaaaacagttgcgctgctcctagaagcaggggcagacccatccctgagaaacaaggccaatgaacttccggcagaactaaccaaaaatgaacgtatattgcgtctcctgagaagtaaagaaggtcccagaaagagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: