ANKRD29-ankyrin repeat domain 29 Gene View larger

ANKRD29-ankyrin repeat domain 29 Gene

PTXBC030622

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ANKRD29-ankyrin repeat domain 29 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ANKRD29-ankyrin repeat domain 29 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030622
Product type: DNA & cDNA
Ncbi symbol: ANKRD29
Origin species: Human
Product name: ANKRD29-ankyrin repeat domain 29 Gene
Size: 2ug
Accessions: BC030622
Gene id: 147463
Gene description: ankyrin repeat domain 29
Synonyms: ankyrin repeat domain-containing protein 29; ankyrin repeat domain 29
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgcaggatgtccttcaagaaggaaactccacttgccaatgctgcattctgggcagccaggagaggaaacctggcgctgctgaagctgctgttgaacagcggccgggtggacgtggactgcagagacagccatggcaccacactcctgatggttgctgcctacgctggccacatagactgtgtgagggaactggttctgcaaggagcagacatcaatctccagagagagtcaggtacaactgccctattctttgccgcccagcaaggccataatgatgtcgtgagatttctctttggatttggagcatccactgaatttaggaccaaagacgagggcaccgccctgttggctgccagtcagtacgggcacatgcaggtggtggagaccttgctgaagcacggagcaaacatccatgaccaactttatgatggagccactgccctcttcctagctgcccaaggtggttacttggatgttattcgattactgctggcttcaggagcaaaagtcaaccagccaaggcaggacgggacagcgcccctgtggatcgcgtcccagatgggccacagcgaggtggtgcgggtgatgctgctgcgcggagccgaccgcgacgctgcgcggaacgatggcacaacagcattattgaaagcagccaacaaagggtataatgatgtcataaaagagttgcttaaattctcacccactcttggtattttgaagaatgggacatcagcgctccatgcagcagtgctcagtggaaacattaaaacagttgcgctgctcctagaagcaggggcagacccatccctgagaaacaaggccaatgaacttccggcagaactaaccaaaaatgaacgtatattgcgtctcctgagaagtaaagaaggtcccagaaagagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - EBNA1 binding protein 2
- phospholipid scramblase 1
- Hermansky-Pudlak syndrome 1
- apoptosis enhancing nuclease

Buy ANKRD29-ankyrin repeat domain 29 Gene now

Add to cart