ROGDI-rogdi homolog (Drosophila) Gene View larger

ROGDI-rogdi homolog (Drosophila) Gene

PTXBC012901

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ROGDI-rogdi homolog (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ROGDI-rogdi homolog (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012901
Product type: DNA & cDNA
Ncbi symbol: ROGDI
Origin species: Human
Product name: ROGDI-rogdi homolog (Drosophila) Gene
Size: 2ug
Accessions: BC012901
Gene id: 79641
Gene description: rogdi homolog (Drosophila)
Synonyms: rogdi homolog; protein rogdi homolog; KTZS; leucine zipper domain protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaccgtgatggcagcgacggcggcggagcgggcggtgctggaggaggagttccgctggctgctgcacgacgaggtgcacgctgtgttgaagcagctgcaggacatcctcaaggaggcctctctgcgcttcactctgccgggctccggcactgaggggcccgccaagcaagagaacttcatcctaggcagctgtggcacagaccaggtgaagggtgtgctgactctgcagggggatgccctcagccaggcggatgtgaacctgaagatgccccggaacaaccagctgctgcacttcgccttccgggaggacaagcagtggaagctgcagcagatccaggatgccagaaaccatgtgagccaagccatttacctgcttaccagccgggaccagagctaccagttcaagacaggcgctgaggtcctcaagctgatggacgcagtgatgctgcagctgaccagagcccgaaaccggctcaccacccccgccaccctcaccctccccgagatcgccgccagcggcctcacgcggatgttcgcccctgccctgccgtccgacctgctggtcaacgtctacatcaacctcaacaagctctgcctcacggtgtaccagctgcatgccctgcagcccaactccaccaagaacttccgcccagctgggggcgcggtgctgcatagccctggggccatgttcgagtggggctctcagcgcctggaggtgagccacgtgcacaaagtggagtgcgtgatcccctggctcaacgacgccctggtctacttcaccgtctccctgcagctctgccagcagctcaaggacaagatctccgtgttctccagctactggagctacagacccttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, matrin type 3
- ventral anterior homeobox 2
- phospholipid scramblase 3
- ECSIT homolog (Drosophila)

Buy ROGDI-rogdi homolog (Drosophila) Gene now

Add to cart