Login to display prices
Login to display prices
CD164-CD164 molecule, sialomucin Gene View larger

CD164-CD164 molecule, sialomucin Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD164-CD164 molecule, sialomucin Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CD164-CD164 molecule, sialomucin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011522
Product type: DNA & cDNA
Ncbi symbol: CD164
Origin species: Human
Product name: CD164-CD164 molecule, sialomucin Gene
Size: 2ug
Accessions: BC011522
Gene id: 8763
Gene description: CD164 molecule, sialomucin
Synonyms: CD164 molecule; CD164 antigen, sialomucin; DFNA66; MGC-24; MGC-24v; MUC-24; endolyn; sialomucin core protein 24; multi-glycosylated core protein 24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgcggctctcccgctcactgctttgggccgccacctgcctgggcgtgctctgcgtgctgtccgcggacaagaacacgacccagcacccgaacgtgacgactttagcgcccatctccaacgtaacctcggcgccggtgacgtccctcccgctggtcaccactccggcaccagaaacctgtgaaggtcgaaacagctgcgtttcctgttttaatgttagcgttgttaatactacctgcttttggatagaatgtaaagatgagagctattgttcacataactcaacagttagtgattgtcaagtggggaacacgacagacttctgttccgtttccacggccactccagtgccaacagccaattctacagctaaacccacagttcagccctccccttctacaacttccaagacagttactacatcaggtacaacaaataacactgtgactccaacctcacaacctgtgcgaaagtctacctttgatgcagccagtttcattggaggaattgtcctggtcttgggtgtgcaggctgtaattttctttctttataaattctgcaaatctaaagaacgaaattaccacactctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - B-cell translocation gene 4
- clathrin, light chain (Lcb)
- myelin expression factor 2
- immunoglobulin lambda locus