Login to display prices
Login to display prices
CLTB-clathrin, light chain (Lcb) Gene View larger

CLTB-clathrin, light chain (Lcb) Gene

PTXBC006332

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLTB-clathrin, light chain (Lcb) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLTB-clathrin, light chain (Lcb) Gene

Proteogenix catalog: PTXBC006332
Ncbi symbol: CLTB
Product name: CLTB-clathrin, light chain (Lcb) Gene
Size: 2ug
Accessions: BC006332
Gene id: 1212
Gene description: clathrin, light chain (Lcb)
Synonyms: LCB; clathrin light chain B; clathrin, light chain (Lcb); clathrin, light polypeptide (Lcb)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgatgactttggcttcttctcgtcgtcggagagcggtgccccggaggcggcggaggaggacccggcggccgccttcctggcccagcaggagagcgagattgcaggcatagagaacgacgagggcttcggggcacctgccggcagccatgcggcccccgcgcagccgggccccacgagtggggctggttctgaggacatggggaccacagtcaatggagatgtgtttcaggaggccaacggtcctgctgatggctacgcagccattgcccaggctgacaggctgacccaggagcctgagagcatccgcaagtggcgagaggagcagaggaaacggctgcaagagctggatgctgcatctaaggtcacggaacaggaatggcgggagaaggccaagaaggacctggaggagtggaaccagcgccagagtgaacaagtagagaagaacaagatcaacaaccgggcatccgaggaggctttcgtgaaggaatccaaggaggagaccccaggcacagagtgggagaaggtggcccagctatgtgacttcaaccccaagagcagcaagcagtgcaaagatgtgtcccgcctgcgctcggtgctcatgtccctgaagcagacgccactgtcccgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: