Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NBL1-neuroblastoma, suppression of tumorigenicity 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NBL1-neuroblastoma, suppression of tumorigenicity 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012037 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NBL1 |
| Origin species: | Human |
| Product name: | NBL1-neuroblastoma, suppression of tumorigenicity 1 Gene |
| Size: | 2ug |
| Accessions: | BC012037 |
| Gene id: | 4681 |
| Gene description: | neuroblastoma, suppression of tumorigenicity 1 |
| Synonyms: | D1S1733E; DAN; DAND1; NO3; neuroblastoma suppressor of tumorigenicity 1; DAN domain family member 1; differential screening-selected gene aberrant in neuroblastoma; neuroblastoma candidate region, suppression of tumorigenicity 1; neuroblastoma 1, DAN family BMP antagonist |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcttcgggtcctggtgggggctgtcctccctgccatgctactggctgccccaccacccatcaacaagctggcactgttcccagataagagtgcctggtgcgaagccaagaacatcacccagatcgtgggccacagcggctgtgaggccaagtccatccagaacagggcgtgcctaggacagtgcttcagctacagcgtccccaacaccttcccacagtccacagagtccctggttcactgtgactcctgcatgccagcccagtccatgtgggagattgtgacgctggagtgcccgggccacgaggaggtgcccagggtggacaagctggtggagaagatcctgcactgtagctgccaggcctgcggcaaggagcctagtcacgaggggctgagcgtctatgtgcagggcgaggacgggccgggatcccagcccggcacccaccctcacccccatccccacccccatcctggcgggcagacccctgagcccgaggacccccctggggccccccacacagaggaagagggggctgaggactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 98, member C - MAD2 mitotic arrest deficient-like 2 (yeast) - family with sequence similarity 54, member A - N-acetyltransferase 8 (GCN5-related, putative) |