Login to display prices
Login to display prices
NBL1-neuroblastoma, suppression of tumorigenicity 1 Gene View larger

NBL1-neuroblastoma, suppression of tumorigenicity 1 Gene

PTXBC012037

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NBL1-neuroblastoma, suppression of tumorigenicity 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NBL1-neuroblastoma, suppression of tumorigenicity 1 Gene

Proteogenix catalog: PTXBC012037
Ncbi symbol: NBL1
Product name: NBL1-neuroblastoma, suppression of tumorigenicity 1 Gene
Size: 2ug
Accessions: BC012037
Gene id: 4681
Gene description: neuroblastoma, suppression of tumorigenicity 1
Synonyms: D1S1733E; DAN; DAND1; NO3; neuroblastoma suppressor of tumorigenicity 1; DAN domain family member 1; differential screening-selected gene aberrant in neuroblastoma; neuroblastoma candidate region, suppression of tumorigenicity 1; neuroblastoma 1, DAN family BMP antagonist
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcttcgggtcctggtgggggctgtcctccctgccatgctactggctgccccaccacccatcaacaagctggcactgttcccagataagagtgcctggtgcgaagccaagaacatcacccagatcgtgggccacagcggctgtgaggccaagtccatccagaacagggcgtgcctaggacagtgcttcagctacagcgtccccaacaccttcccacagtccacagagtccctggttcactgtgactcctgcatgccagcccagtccatgtgggagattgtgacgctggagtgcccgggccacgaggaggtgcccagggtggacaagctggtggagaagatcctgcactgtagctgccaggcctgcggcaaggagcctagtcacgaggggctgagcgtctatgtgcagggcgaggacgggccgggatcccagcccggcacccaccctcacccccatccccacccccatcctggcgggcagacccctgagcccgaggacccccctggggccccccacacagaggaagagggggctgaggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice