Login to display prices
Login to display prices
RGS3-regulator of G-protein signaling 3 Gene View larger

RGS3-regulator of G-protein signaling 3 Gene

PTXBC019039

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RGS3-regulator of G-protein signaling 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RGS3-regulator of G-protein signaling 3 Gene

Proteogenix catalog: PTXBC019039
Ncbi symbol: RGS3
Product name: RGS3-regulator of G-protein signaling 3 Gene
Size: 2ug
Accessions: BC019039
Gene id: 5998
Gene description: regulator of G-protein signaling 3
Synonyms: C2PA; RGP3; regulator of G-protein signaling 3; regulator of G-protein signalling 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggaagccaaggacatgaagaacaagctggggatcttcagacggcggaatgagtcccctggagcccctcccgcgggcaaggcagacaaaatgatgaagtcattcaagcccacctcagaggaagccctcaagtggggcgagtccttggagaagctgctggttcacaaatacgggttagcagtgttccaagccttccttcgcactgagttcagtgaggagaatctggagttctggttggcttgtgaggacttcaagaaggtcaagtcacagtccaagatggcatccaaggccaagaagatctttgctgaatacatcgcgatccaggcatgcaaggaggtcaacctggactcctacacgcgggagcacaccaaggacaacctgcagagcgtcacgcggggctgcttcgacctggcacagaagcgcatcttcgggctcatggaaaaggactcgtaccctcgctttctccgttctgacctctacctggaccttattaaccagaagaagatgagtcccccgctttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice